N2O emission contributions by different pathways and associated microbial community dynamics in a typical calcareous vegetable soil

Guo, Liping; Wang, Xue Dong; Diao, Tiantian; Ju, Xiaotang; Niu, Xiaoguang; Zheng, Lei; Zhang, Xinyue; Han, Xue

doi:10.1016/j.envpol.2018.07.028

Cited by 24 publications

(8 citation statements)

References 53 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Fungi enable to decompose recalcitrant carbon substrate [35] and have lower oxygen demands than bacteria. Soil pH in the rhizospheric zone is usually lower due to the ammonium uptake by roots and nitrification in the dryland soils after fertilization [36,37]. Fungi were more suitable for growing in acidic conditions even when pH reached to pH 4.5 [38,39].…”

Section: Effects Of Elevated Co 2 On Soil Carbon and Associated Microbesmentioning

confidence: 99%

Changes of Soil Microbes Related with Carbon and Nitrogen Cycling after Long-Term CO2 Enrichment in a Typical Chinese Maize Field

et al. 2020

Self Cite

View full text Add to dashboard Cite

Elevated atmospheric CO 2 concentration (eCO 2 ) has been the most important driving factor and characteristic of climate change. To clarify the effects of eCO 2 on the soil microbes and on the concurrent status of soil carbon and nitrogen, an experiment was conducted in a typical summer maize field based on a 10-year mini FACE (Free Air Carbon Dioxide Enrichment) system in North China. Both rhizospheric and bulk soils were collected for measurement. The soil microbial carbon (MBC), nitrogen (MBN), and soil mineral N were measured at two stages. Characteristics of microbes were assayed for both rhizospheric soil and bulk soils at the key stage. We examined the plasmid copy numbers, diversities, and community structures of bacteria (in terms of 16s rRNA), fungi (in terms of ITS-internal transcribed spacer), ammonia oxidizing bacteria (AOB) and denitrifiers including nirK, nirS, and nosZ using the Miseq sequencing technique. Results showed that under eCO 2 conditions, both MBC and MBN in rhizospheric soil were increased significantly. The quantity of ITS was increased in the eCO 2 treatment compared with that in the ambient CO 2 (aCO 2 ) treatment, while the quantity of 16s rRNA in rhizospheric soil showed decrease in the rhizospheric soil in the eCO 2 treatment. ECO 2 changed the relative abundance of microbes in terms of compositional proportion of some orders or genera particularly in the rhizospheric soil-n particular, Chaetomium increased for ITS, Subgroups 4 and 6 increased for 16s rRNA, Nitrosospira decreased for AOB, and some genera showed increase for nirS, nirK, and nosZ. Nitrate N was the main inorganic nitrogen form at the tasseling stage and both quantities of AOB and denitrifiers, as well as the nosZ/(nirS+nirK) showed an increase under eCO 2 conditions particularly in the rhizospheric soil. The Nitrosospira decreased in abundance under eCO 2 conditions in the rhizospheric soil and some genera of denitrifiers also showed differences in abundance. ECO 2 did not change the diversities of microbes significantly. In general, results suggested that 10 years of eCO 2 did affect the active component of C and N pools (such as MBC and MBN) and both the quantities and relative abundance of microbes which are involved in carbon and nitrogen cycling, possibly due to the differences in both the quantities and component of substrate for relevant microbes in the rhizospheric soils.

show abstract

Section: Effects Of Elevated Co 2 On Soil Carbon and Associated Microbesmentioning

confidence: 99%

Changes of Soil Microbes Related with Carbon and Nitrogen Cycling after Long-Term CO2 Enrichment in a Typical Chinese Maize Field

et al. 2020

Self Cite

View full text Add to dashboard Cite

show abstract

“…Each PCR reaction mixture (20 μL) contained 10 ng of template DNA, 10 μL ChamQ SYBR Colour qPCR Master Mix (Vazyme), and 0.5 μL of each primer (5 μm; Forward: 5’‐ACTCCTACGGGAGGCAGCAG‐3′; Reverse: 5’‐GGACTACHVGGGTWTCTAAT‐3′) (Chu et al ., 2015). The qPCR reactions were performed in triplicate under thermal cycler conditions of 5 min at 95°C, and 40 cycles of 30 s at 95°C, 30 s at 55°C, and 40 s at 72°C in LineGene9600plus Real‐Time PCR Detection System (BioRad) (Guo et al ., 2018). All results were normalized and calculated using the ΔCt method (Livak & Schmittgen, 2001).…”

Section: Methodsmentioning

confidence: 99%

Bacillus amyloliquefaciens application to prevent biofilms in reclaimed water microirrigation systems*

Wen

Xiao

Song

et al. 2020

Irrigation and Drainage

View full text Add to dashboard Cite

Reclaimed water (RW) applied in drip irrigation systems could be a solution to cope with the challenges of limited freshwater resources. Biofilm growth in irrigation systems is an unavoidable issue when using RW. To date, strong chemical bactericides mostly dominate the commercial market in controlling biofilms. However, recently scientists have been concerned about their real efficacy and environmental risks. This study assesses a low‐concentration microbial antagonist (i.e., Bacillus amyloliquefaciens inoculums, BAI) intermittently injected into the systems to mitigate biofilm formation in three types of drip emitters using two kinds of treated RW. The results indicated that the application of BAI significantly (p < .05) mitigated the microbial biomass within biofilms when compared with the control groups (no‐BAI). In addition, BAI reduced the contents of extracellular polysaccharides and proteins of biofilms, which decreased the total biomass in BAI treatments by 44.9%–73.8%. Consequently, BAI effectively improved the emitter performances and increased the discharge variation rate by 31.9%–44.3%. These findings might provide a new perspective to control biofouling when applying RW in irrigation systems, with potential implications for sustainable water management in agricultural production.

show abstract

“…At a soil water content range of around 35-60% WFPS, the contribution of nitrification to N 2 O emissions was increased with the increase of soil WFPS [64]. Moreover, in the fertilized upland soil, nitrifier denitrification was reported to be the main pathway of N 2 O emissions due to sub-aeration after a few days after fertilization combined with irrigation, which derived from oxygen depletion by strong ammonia oxidization following ammonium-N application, the first step of the nitrification process [65][66][67]. It was reported that nitrifier denitrification contributed about 60% of the total N 2 O emissions during the earlier period of N application in the typical calcareous soil [65].…”

Section: The Response Of N 2 O Emissions To Ecomentioning

confidence: 99%

“…Moreover, in the fertilized upland soil, nitrifier denitrification was reported to be the main pathway of N 2 O emissions due to sub-aeration after a few days after fertilization combined with irrigation, which derived from oxygen depletion by strong ammonia oxidization following ammonium-N application, the first step of the nitrification process [65][66][67]. It was reported that nitrifier denitrification contributed about 60% of the total N 2 O emissions during the earlier period of N application in the typical calcareous soil [65]. Zhu et al [67] found that the total N 2 O emissions decreased 19-fold when the O 2 concentration increased from 3% to 21%, and the contribution of nitrifier denitrification reduced from 57% to 38% on average in urea-amended soil.…”

Section: The Response Of N 2 O Emissions To Ecomentioning

confidence: 99%

Impacts of Elevated Atmospheric CO2 and N Fertilization on N2O Emissions and Dynamics of Associated Soil Labile C Components and Mineral N in a Maize Field in the North China Plain

Wei

et al. 2022

Agronomy

Self Cite

View full text Add to dashboard Cite

The elevated atmospheric CO2 concentration (eCO2) is expected to increase the labile C input to the soil, which may stimulate microbial activity and soil N2O emissions derived from nitrification and denitrification. However, few studies studied the effect of eCO2 on N2O emissions from maize field under the free-air CO2 enrichment (FACE) conditions in the warm temperate zone. Here, we report a study conducted during the 12th summer maize season under long-term eCO2, aiming to investigate the effect of eCO2 on N2O emissions. Moreover, we tested zero and conventional N fertilization treatments, with maize being grown under either eCO2 or ambient CO2 (aCO2). We hypothesized that N2O emissions would be increased under eCO2 due to changes in soil labile C and mineral N derived from C-deposition, and that the increase would be larger when eCO2 was combined with conventional N fertilization. We also measured the activities of some soil extracellular enzymes, which could reflect soil C status. The results showed that, under eCO2, seasonal N2O and CO2 emissions increased by 12.4–15.6% (p < 0.1) and 13.8–18.5% (p < 0.05), respectively. N fertilization significantly increased the seasonal emissions of N2O and CO2 by 33.1–36.9% and 17.1–21.8%, respectively. Furthermore, the combination of eCO2 and N fertilization increased the intensity of soil N2O and CO2 emissions. The marginal significant increase in N2O emissions under eCO2 was mostly due to the lower soil water regime after fertilization in the study year. Dissolved organic C (DOC) and microbial biomass C (MBC) concentration showed a significant increase at most major stages, particularly at the tasseling stage during the summer maize growth period under eCO2. In contrast, soil mineral N showed a significant decrease under eCO2 particularly in the rhizospheric soils. The activities of C-related soil extracellular enzymes were significantly higher under eCO2, particularly at the tasseling stage, which coincided with concurrent increased DOC and MBC under eCO2. We conclude that eCO2 increases N2O emissions, and causes a higher increase when combined with N fertilization, but the increase extent of N2O emissions was influenced by environmental factors, especially by soil water, to a great extent. We highlighted the urgent need to monitor long-term N2O emissions and N2O production pathways in various hydrothermal regimes under eCO2.

show abstract

N2O emission contributions by different pathways and associated microbial community dynamics in a typical calcareous vegetable soil

Cited by 24 publications

References 53 publications

Changes of Soil Microbes Related with Carbon and Nitrogen Cycling after Long-Term CO2 Enrichment in a Typical Chinese Maize Field

Changes of Soil Microbes Related with Carbon and Nitrogen Cycling after Long-Term CO2 Enrichment in a Typical Chinese Maize Field

Bacillus amyloliquefaciens application to prevent biofilms in reclaimed water microirrigation systems*

Impacts of Elevated Atmospheric CO2 and N Fertilization on N2O Emissions and Dynamics of Associated Soil Labile C Components and Mineral N in a Maize Field in the North China Plain

Contact Info

Product

Resources

About