Myomedin scaffold variants targeted to 10E8 HIV-1 broadly neutralizing antibody mimic gp41 epitope and elicit HIV-1 virus-neutralizing sera in mice

Abstract

One of the proposed strategies for the development of a more efficient HIV-1 vaccine is based on the identification of proteins binding to a paratope of chosen broadly neutralizing antibody (bNAb) that will mimic cognate HIV-1 Env (glyco)protein epitope and could be used as potent immunogens for induction of protective virus-neutralizing antibodies in the immunized individuals. To verify this "non-cognate ligand" concept, we developed a highly complex combinatorial library designed on a scaffold of human myomesin-1 protein domain and selected proteins called Myomedins specifically binding to variable regions of HIV-1 broadly neutralizing antibody 10E8. Immunization of mice with these Myomedin variants elicited the production of HIV-1 Env-specific antibodies. Hyperimmune sera bound to Env pseudotyped viruses and weakly/moderately neutralized 54% of tested clade A, B, C, and AE pseudotyped viruses variants in vitro. These results demonstrate that Myomedin variants have the potential to mimic Env epitopes and could be used as potential HIV-1 vaccine components.

Myomedin replicas of gp120 V3 loop glycan epitopes recognized by PGT121 and PGT126 antibodies as non-cognate antigens for stimulation of HIV-1 broadly neutralizing antibodies

“…The combinatorial library of Myomedin variants was designed and assembled using a series of polymerase chain reactions (PCR) by Phusion High-Fidelity DNA Polymerase (NEB, Massachusetts, USA), as reported earlier ( 26 ).…”

“…The combinatorial Myomedin variant library was used for three rounds of in vitro transcription/translation and RD selection, as reported earlier ( 26 ). Then, 96-well PolySorp plates (Thermo Scientific™ Clear Flat-Bottom Immuno Nonsterile 96-Well Plates) were immobilized with a constant concentration (25 µg ml -1 ) of human IgG1 λ type and varied concentrations (first round: 50 µg ml -1 , second round: 50 µg ml -1 , third round: 20 µg ml -1 ) of PGT121 or PGT126 bNAbs in 100 mM bicarbonate/carbonate buffer (pH 9.6) were used to conduct the preselection and adjust the stringency during each round of RD selection, respectively.…”

“…To increase the stringency during each round of RD selection, different concentrations of TWEEN 20 in phosphate buffered (pH 7.2), i.e., 0.05% Tween/5 times, 0.05% Tween/10 times, and 0.25% Tween/10 times were used in the first, second, and third cycle, respectively. Following, the complementary DNA (cDNA) collected from the third round of RD selection was amplified into double-stranded DNA using PCR with primers JOIN-F(CTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGAAAAGCGAGCTGGCCG) and JOIN-R (GAACCGACCGCGGATCCACCCTGTTTACGAATCCATTCTT), and the resulting product was further amplified with primers His-Myo-F (CAGTCCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCAAAAGCGAGCTGGCCG) and JOIN-R to insert cloning sites, as reported earlier ( 26 ). Finally, the amplified combinatorial Myomedin library DNA was digested using NcoI/BamHI restriction enzymes and inserted as a fusion with the V5-tag sequence in a pET-28b cloning vector resulting in the cloned cDNA plasmid library that was used to transform E. coli XL1 blue host cells.…”

“…Hyperimmune mouse sera show the neutralization of HIV-1 pseudoviruses of Clades B and C in vitro ( 24 ). This approach, designated as the “Non-cognate ligand strategy” (NCLS) ( 25 ), was used to develop Myomedin scaffold-derived MLA proteins mimicking epitope of 10E8 bNAb in the membrane-proximal external region (MPER) of gp41 protein ( 26 ). Elicited anti-Myomedin mouse sera antibodies moderately neutralized up to 12 of 22 tested HIV-1 pseudoviruses of Clades A, B and C ( 26 ).…”

“…This approach, designated as the “Non-cognate ligand strategy” (NCLS) ( 25 ), was used to develop Myomedin scaffold-derived MLA proteins mimicking epitope of 10E8 bNAb in the membrane-proximal external region (MPER) of gp41 protein ( 26 ). Elicited anti-Myomedin mouse sera antibodies moderately neutralized up to 12 of 22 tested HIV-1 pseudoviruses of Clades A, B and C ( 26 ). As glycan epitopes located in a high-mannose patch of gp120 protein represent prominent targets of several HIV-1 bNAbs, we employed the NCLS approach to select protein imprints of glycan supersite targeting paratopes of PGT121 and PGT126 bNAbs using a highly complex Myomedin scaffold library and identified several protein variants with shape and electrostatic complementarity that mimic cognate glycan epitopes.…”