Myocardium-specific Isca1 knockout causes iron metabolism disorder and myocardial oncosis in rat

Ling, Yahao; Yang, Xinlan; Zhang, Xu; Guan, Feifei; Qi, Xiaolong; Dong, Wei; Liu, Mengdi; Ma, Jiaxin; Jiang, Xiaoyu; Gao, Kai; Li, Jing; Chen, Wei; Gao, Shan; Gao, Xiang; Pan, Shuo; Wang, Jizheng; Ma, Yuanwu; Lu, Dongfang; Zhang, Lianfeng

doi:10.1016/j.lfs.2022.120485

Cited by 5 publications

(13 citation statements)

References 61 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The CKO rats were screened using tail DNA genotyping procedures. 14 DNA was extracted from the tail tissues of neonatal rats using the EasyPure® Genomic DNA Kit (China, Trans Gen Biotech, EE101‐22). Isca1 was amplified with primers of 5′ ATGGTTCCAGCACTTTGAAGG and 5′ AAGCTAATATGACAGTGGTGAGGC under the following conditions: 95°C 30 s, 59°C 30 s, and 72°C 2 min, for 35 cycles.…”

Section: Methodsmentioning

confidence: 99%

“…Survival analysis was performed as described previously. 14 The cumulative mortality of the littermates including homozygous CKO and wild‐type rats was recorded from birth to 10 weeks of age. The Kaplan–Meier curves were analyzed using GraphPad Prism8 software through comparison with the log‐rank test.…”

Section: Methodsmentioning

confidence: 99%

“… 13 Myocardium‐specific ISCA1 homozygous knockout rats exhibited myocardial oncosis, heart failure, and early death within 10 days of birth. 14 …”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

A neuron‐specific Isca1 knockout rat developments multiple mitochondrial dysfunction syndromes

Sheng

et al. 2023

Anim Models and Exp Med

Self Cite

View full text Add to dashboard Cite

Background Multiple mitochondrial dysfunction syndromes (MMDS) are rare mitochondrial diseases caused by mutation of mitochondrial iron–sulfur cluster synthesis proteins. This study established a rat model simulating MMDS5 disease in the nervous system to investigate its pathological features and neuronal death. Methods We generated neuron‐specific Isca1 knockout rat (Isca1flox/flox ‐NeuN‐Cre) using CRISPR‐Cas9 technology. The brain structure changes of CKO rats were studied with MRI, and the behavior abnormalities were analyzed through gait analysis and open field tests, Y maze tests and food maze tests. The pathological changes of neurons were analyzed through H&E staining, Nissl staining, and Golgi staining. Mitochondrial damage was assessed by TEM, western blot and ATP assay, and the morphology of neurons was assessed by WGA immunofluorescence to detect the death of neurons. Results This study established the disease model of MMDS5 in the nervous system for the first time, and found that after Isca1 loss, the rats suffered from developmental retardation, epilepsy, memory impairment, massive neuronal death, reduced number of Nissl bodies and dendritic spines, mitochondrial fragmentation, cristae fracture, reduced content of respiratory chain complex protein, and reduced production of ATP. Isca1 knockout caused neuronal oncosis. Conclusions This rat model can be used to study the pathogenesis of MMDS. In addition, compared with human MMDS5, the rat model can survive up to 8 weeks of age, effectively extending the window of clinical treatment research, and can be used for the treatment of neurological symptoms in other mitochondrial diseases.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

A neuron‐specific Isca1 knockout rat developments multiple mitochondrial dysfunction syndromes

Sheng

et al. 2023

Anim Models and Exp Med

Self Cite

View full text Add to dashboard Cite

show abstract

“…The mitochondrial structure of the cardiac muscle was observed by TEM as previously described ( 55 ). The fresh heart tissues were collected and fixed in 2.5% glutaraldehyde (P1126, Solarbio) after perfusion with ice-cold PBS.…”

Section: Methodsmentioning

confidence: 99%

A conditional knockout rat resource of mitochondrial protein-coding genes via a DdCBE-induced premature stop codon

Tan

Kong

et al. 2023

Sci. Adv.

Self Cite

View full text Add to dashboard Cite

Hundreds of pathogenic variants of mitochondrial DNA (mtDNA) have been reported to cause mitochondrial diseases, which still lack effective treatments. It is a huge challenge to install these mutations one by one. We repurposed the DddA-derived cytosine base editor to incorporate a premature stop codon in the mtProtein-coding genes to ablate mitochondrial proteins encoded in the mtDNA (mtProteins) instead of installing pathogenic variants and generated a library of both cell and rat resources with mtProtein depletion. In vitro, we depleted 12 of 13 mtProtein-coding genes with high efficiency and specificity, resulting in decreased mtProtein levels and impaired oxidative phosphorylation. Moreover, we generated six conditional knockout rat strains to ablate mtProteins using Cre/loxP system . Mitochondrially encoded ATP synthase membrane subunit 8 and NADH:ubiquinone oxidoreductase core subunit 1 were specifically depleted in heart cells or neurons, resulting in heart failure or abnormal brain development. Our work provides cell and rat resources for studying the function of mtProtein-coding genes and therapeutic strategies.

show abstract

“…From 3 months of age, rats manifest an echocardiographic and histopathological phenotype of DCM, characterized by LV wall thinning and dilatation, contractile impairment, myocardial lysis and fibrosis. The subcellular mechanisms of mitochondrial dysfunction syndromes were clearly represented in this model, with swollen mitochondria containing damaged membrane structure and partial absence of crests, together with reduced expression levels of key enzymes for ATP synthesis and iron homeostasis [ 129 , 130 ].…”

Section: Genetic Modelsmentioning

confidence: 99%

Rodent Models of Dilated Cardiomyopathy and Heart Failure for Translational Investigations and Therapeutic Discovery

Ponzoni

Coles

Maynes

2023

IJMS

View full text Add to dashboard Cite

Even with modern therapy, patients with heart failure only have a 50% five-year survival rate. To improve the development of new therapeutic strategies, preclinical models of disease are needed to properly emulate the human condition. Determining the most appropriate model represents the first key step for reliable and translatable experimental research. Rodent models of heart failure provide a strategic compromise between human in vivo similarity and the ability to perform a larger number of experiments and explore many therapeutic candidates. We herein review the currently available rodent models of heart failure, summarizing their physiopathological basis, the timeline of the development of ventricular failure, and their specific clinical features. In order to facilitate the future planning of investigations in the field of heart failure, a detailed overview of the advantages and possible drawbacks of each model is provided.

show abstract

Myocardium-specific Isca1 knockout causes iron metabolism disorder and myocardial oncosis in rat

Cited by 5 publications

References 61 publications

A neuron‐specific Isca1 knockout rat developments multiple mitochondrial dysfunction syndromes

A neuron‐specific Isca1 knockout rat developments multiple mitochondrial dysfunction syndromes

A conditional knockout rat resource of mitochondrial protein-coding genes via a DdCBE-induced premature stop codon

Rodent Models of Dilated Cardiomyopathy and Heart Failure for Translational Investigations and Therapeutic Discovery

Contact Info

Product

Resources

About