MxA Induction May Predict Sustained Virologic Responses of Chronic Hepatitis B Patients with IFN-<i>α</i> Treatment

Kong, Xiao‐Fei; Zhang, Xinxin; Gong, Qiming; Gao, Jian; Zhang, Shen-Ying; Wang, Lin; Xu, Jie; Han, Yue; Jin, Gen-Di; Jiang, Jie-Hong; Zhang, Donghua; Lu, Zhongmin

doi:10.1089/jir.2006.0163

Cited by 23 publications

(22 citation statements)

References 42 publications

(45 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Although it belongs to the JAK-STAT signaling pathway, IL-29 is linked closely with TLR signaling pathways according to the interaction network and up-regulates MX1 expression, a key component of the antiviral state induced by IFNs, which inhibits HBV replication at a posttranscriptional level [35–37]. The elevation of IL-29 in the inactive and resolved groups, suggested that IL-29 plays an important role in anti-HBV immunity, especially compared with IFN-γ.…”

Section: Discussionmentioning

confidence: 99%

Expression Pattern of Serum Cytokines in Hepatitis B Virus Infected Patients with Persistently Normal Alanine Aminotransferase Levels

Guo

et al. 2013

J Clin Immunol

View full text Add to dashboard Cite

PurposeAbout 60–80 % of chronic hepatitis B virus (HBV) carriers are characterized with persistently normal alanine transaminase (ALT). Differences of cytokine expression are associated with the prognosis of HBV infection. We investigated the expression pattern of 30 cytokines associated with anti-HBV immunity in patients with normal ALT.MethodsFour patient groups (immune tolerance, inactive hepatitis B surface antigen carriers, resolved hepatitis B, and control; 10 subjects per group) were assigned. Thirty cytokines, including IFN-γ, IL-1β, IL-2, IL-4, IL-6, IL-7, IL-9, IL-10, IL-12p40, IL-12p70, IL-15, IL-17A, IL-17C, IL-21, IL-22, IL-23p19, IL-28A, IL-29, CCL5, CCL16, CCL20, CCL22, CXCL9, CXCL10, CXCL11, TNFRSF8, TNFRSF18, IL-6R, gp130, and TGF-β1, were measured using a human cytokine antibody array. Signal intensities were obtained by laser scanner. Protein-protein interactions were analyzed by STRING (Search Tool for the Retrieval of Interacting Genes/Proteins).ResultsSignificant differences of signal intensities were observed for IL-2, IL-4, IL-6, IL-7, IL-9, IL-10, IL-12p40, IL-12p70, IL-15, IL-21, IL-23p19, IL-28A, and IL-29. The lowest intensity was in controls. Among three HBV infection groups, significant differences were observed in IL-2, IL-4, IL-12p70, IL-15, IL-21, IL-23p19, and IL-29. The highest intensity was in the inactive group. All cytokines with significant differences were involved JAK-STAT signaling that up-regulate FOXP3, SOCS3 and MX1.ConclusionDifferential expression of cytokines in JAK-STAT signaling is an important factor associated with prognosis of HBV infection. The elevation of γC cytokines, IL-12p70, IL-23p19, and IL-29 may promote spontaneous HBeAg seroconversion and HBV clearance.Electronic supplementary materialThe online version of this article (doi:10.1007/s10875-013-9931-0) contains supplementary material, which is available to authorized users.

show abstract

Section: Discussionmentioning

confidence: 99%

Expression Pattern of Serum Cytokines in Hepatitis B Virus Infected Patients with Persistently Normal Alanine Aminotransferase Levels

Guo

et al. 2013

J Clin Immunol

View full text Add to dashboard Cite

show abstract

“…MxA quantification was performed as we have previously described [17]. In brief, peripheral blood mononuclear cells (PBMC) were isolated from venous blood by Ficoll–hypaque gradient sedimentation.…”

Section: Methodsmentioning

confidence: 99%

Association study of IFNAR2 and IL10RB genes with the susceptibility and interferon response in HBV infection

Gong

Kong

Yang³

et al. 2009

Journal of Viral Hepatitis

View full text Add to dashboard Cite

A recent genome-wide association study discovered that two polymorphisms, interferon (IFN) alpha receptor 2 (IFNAR-2) F8S and interleukin 10 receptor (IL10RB) K47E, were associated with susceptibility to hepatitis B virus (HBV) infection in Africa. Here, we reevaluate the effects of the two polymorphisms on HBV susceptibility in the Chinese Han population, and extended the study to look at their association with IFN response in chronic hepatitis B (CHB). We included 341 patients with CHB and 341 unrelated controls presenting with asymptotic HBV self-limited infection, who were well matched in age and sex. In the CHB group, 101 patients had been treated with peg-IFN-alpha-2a for 48 weeks and followed up for 24 weeks to determine the clinical response, resulting 34 individuals with sustained virological response (SVR) and 67 individuals with nonsustained response (NR). Subgroups in the CHB group were divided according to the viral loads, HBeAg and maternal HBsAg status. The association with the susceptibility to HBV infection was only observed for IL10RB K47E when we compared the individuals with persistent HBV infection through nonmaternal transmission to the controls with asymptomatic self-limited HBV infection. Further, we found that the IFNAR2-8SS genotype was associated with HBeAg negative patients (OR = 0.316, 95% CI: 0.121-0.825, P = 0.019) and that the IFNAR2-8F allele was associated with the risk to high viral loads (OR = 1.667, 95% CI: 1.148-2.420, P = 0.007). In addition, the IFNAR2-8FF genotype predisposed to higher MxA gene induction and correlated with sustained IFN response (OR = 0.348, 95% CI: 0.129-0.935, P = 0.036). Haplotype analysis based on polymorphisms of three single-nucleotide polymorphisms, MxA - 88 G/T, IFNAR-2 F8S and IL10RB K47E showed that the haplotype distribution was significantly different between the SVR and NR groups (P = 0.040). This study suggests that IFNAR2 may play an important role in determining IFN response and clinical phenotypes of HBV infection in the Chinese Han population.

show abstract

“…The SD6 (TCTGAGTCACCTG-GACAACC) and SA2 (ATCTCAGTGGTATTTGTGAGC) primers for pSPL3 plasmids were used for amplifications for the analysis of potential splicing. GADPH was amplified as previously described (51). All of these steps were performed according to the kit manufacturer's instructions.…”

Section: Figurementioning

confidence: 99%

A partial form of recessive STAT1 deficiency in humans

Chapgier¹,

Kong²,

et al. 2009

Self Cite

View full text Add to dashboard Cite

MxA Induction May Predict Sustained Virologic Responses of Chronic Hepatitis B Patients with IFN-α Treatment

Cited by 23 publications

References 42 publications

Expression Pattern of Serum Cytokines in Hepatitis B Virus Infected Patients with Persistently Normal Alanine Aminotransferase Levels

Expression Pattern of Serum Cytokines in Hepatitis B Virus Infected Patients with Persistently Normal Alanine Aminotransferase Levels

Association study of IFNAR2 and IL10RB genes with the susceptibility and interferon response in HBV infection

A partial form of recessive STAT1 deficiency in humans

Contact Info

Product

Resources

About