Mutual interaction between YAP and CREB promotes tumorigenesis in liver cancer

Abstract

Yes-associated protein (YAP), the downstream effecter of the Hippo-signaling pathway as well as cyclic adenosine monophosphate response element-binding protein (CREB), has been linked to hepatocarcinogenesis. However, little is known about whether and how YAP and CREB interact with each other. In this study, we found that YAP-CREB interaction is critical for liver cancer cell survival and maintenance of transformative phenotypes, both in vitro and in vivo. Moreover, both CREB and YAP proteins are highly expressed in a subset of human liver cancer samples and are closely correlated. Mechanistically, CREB promotes YAP transcriptional output through binding to 2608/ 2439, a novel region from the YAP promoter. By contrast, YAP promotes protein stabilization of CREB through interaction with mitogen-activated protein kinase 14 (MAPK14/p38) and beta-transducin repeat containing E3 ubiquitin protein ligase (BTRC). Gain-of-function and loss-of-function studies demonstrated that phosphorylation of CREB by MAPK14/p38 at ser133 ultimately leads to its degradation. Such effects can be enhanced by BTRC through phosphorylation of MAPK14/p38 at Thr180/Tyr182. However, YAP negatively controls phosphorylation of MAPK14/p38 through inhibition of BTRC expression. Conclusion: There is a novel positive autoregulatory feedback loop underlying the interaction between YAP and CREB in liver cancer, suggesting that YAP and CREB form a nexus to integrate the protein kinase A, Hippo/ YAP, and MAPK14/p38 pathways in cancer cells and thus may be helpful in the development of effective diagnosis and treatment strategies against liver cancer. (HEPATOLOGY 2013;58:1011-1020 L iver cancer is the fifth-most common cancer worldwide and the third-leading cause of cancer death. 1 The treatment options for these hepatic malignancies are extremely limited, mainly because the mechanisms of pathogenesis of these cancers are not completely known. Recently, the dysfunctional Hippo/ Yes-associated protein (YAP)-signaling pathway has been linked to hepatocarcinogenesis. 2 Transgenic mice with liver-targeted YAP overexpression demonstrated a dramatic increase in liver size and eventually developed tumors. 3 In addition, clinical studies revealed that YAP was overexpressed in 62% of hepatocellular carcinoma (HCC) patients and was an independent predictor associated with poor disease-free survival and overall

CD166 plays a pro-carcinogenic role in liver cancer cells via inhibition of FOXO proteins through AKT

“…Thus, we consider that CD166 plays a similar role to that of TRIB2. YAP is a pro-carcinogenic protein (7,12), while FOXO proteins are anti-carcinogenic in liver cancer. However, whether and how YAP antagonizes FOXO still remains unknown and needs further exploration.…”

“…Cell proliferation was measured by an MTT-based proliferation assay, as previously described (12). Caspase-3/7 activity was determined using the Caspase-Glo 3/7 assay system (Promega, Madison, WI, USA).…”

“…Caspase-3/7 activity was determined using the Caspase-Glo 3/7 assay system (Promega, Madison, WI, USA). Anchorage-independent soft agar growth assay and quantitative RT-PCR was performed as previously described (12).…”

MEK1 promotes YAP and their interaction is critical for tumorigenesis in liver cancer

“…Cells were treated by PD98059 (15-50 lM, Cell Signaling Technology (CST), Boston, MA, USA) or U0126 (1)(2)(3)(4)(5)(6)(7)(8)(9)(10)(11)(12)(13)(14)(15)(16)(17)(18)(19)(20) lM, CST) 24 h before harvest. ShRNAs were cloned into pLKO.1 lentiviral vectors using primers as follows: MEK1-sh#1-Forward: CCGGAACTCTGGATCAAGTCCTGAACTCGAGTTCAGGACTTGATCCA-GAGTTTTTTTG and Reward: AATTCAAAAAAACTCTGGATCAAGTC C TGAACTCGAGTTCAGGACTTGATCCAGAGTT; MEK1-sh#2-Forward: CCGGAAGGACTCATTACTCTGTGCACTCGAGTGCACAGAGTAATGAGT CCTTTTTTTG and Reward: AATTCAAAAAAAGGACTCATTACTCTG TGCACTCGAGTGCACAGAGTAATGAGTCCTT.…”

“…Although much is known about its function, the cross-talk between YAP and other pathways is still poorly understood. Recently, we indentified a close relationship between YAP and CREB, which forms a positive regulatory feedback relying on the Mitogen-activated protein kinase 14 (MAPK14)/P38 [8]. However, overexpression of CREB only partly rescued inhibitory effects induced by knockdown of YAP [8], leading us to explore potential proteins contributing to YAP carcinogenic property in liver cancer.…”