Mutations in the protein kinase A R1α regulatory subunit cause familial cardiac myxomas and Carney complex

Abstract

While our work was in preparation for submission, we were apprised of the fact that Stratakis et al. had independently reached a similar conclusion regarding the identification of mutations in the gene encoding PRKAR1α in patients with Carney complex. These findings were subsequently published in

GH‐secreting pituitary adenomas infrequently contain inactivating mutations of PRKAR1A and LOH of 17q23–24

“…In addition, nucleotide sequences of exon 2 and exons 1a (noncoding exon) and 1b (noncoding exon) were obtained from a BAC clone RP11–120M18 (AC079210) and 5′ flanking region of PRKAR1A (Y07641), respectively. We synthesized oligonucleotide primers for exons 3–11 and their flanking intronic regions according to the report by Casey et al . (2000), but designed new oligonucleotide primers for exons 1a, 1b and 2: Exon 1a: 5′‐AGGAGTCGCCCACCTGTCATCTGA3′/5′CTTATCCACAGCAGTTTCCTCACG‐3′; Exon 1b: 5′‐ACGTC AGTAGCCGAACGCTGATTG‐3′/5′‐ACGCCATCTTGGATCGGTCCAGCT‐3′; Exon 2: 5′‐TCCCTGTGAATCAGTTGTCTAAT‐3′/5′‐ATGTAACAACTGTCACAATCACC‐3′.…”

“…Genetic defects of Carney complex are mapped to chromosomal region 2p16 (Stratakis et al ., 1996) and 17q22–24 (Casey et al ., 1998). The PRKAR1A gene encoding the R1α regulatory subunit of cAMP‐dependent protein kinase A (PKA) was mapped to 17q22–24, and several mutations of the gene were detected in some kindreds of individuals with Carney complex (Casey et al ., 2000; Kirschner et al ., 2000a). Based on these results, we hypothesized that PRKAR1A could function as a tumour suppressor gene in some sporadic GH‐secreting adenomas.…”

A novel PRKAR1A mutation associated with hepatocellular carcinoma in a young patient and a variable Carney complex phenotype in affected subjects in older generations

“…Recently 7,8 mutations were identified in the PRKAR1A gene in CNC families that were genetically mapped to 17q22–24 and sporadic cases. The PRKAR1A gene encodes the type 1α regulatory subunit (R1α) of the cAMP‐dependent protein kinase (PKA) 9 .…”

Does the prevalence of gsp mutations in GH‐secreting pituitary adenomas differ geographically or racially? Prevalence of gsp mutations in Japanese patients revisited

“…It is the first known potential cause of endocrine adenomas that was discovered through research on GH‐secreting pituitary adenomas 1 . This discovery was followed by the identification of men1 gene mutations 2 and PRKARIA gene mutations 3,4 for MEN‐1 associated‐ and Carney complex associated‐ GH‐secreting pituitary tumours, respectively. However, gsp mutations remain the only known major genetic alterations of sporadic nonfamilial GH‐secreting pituitary adenomas to date.…”