Mutation of B-Raf in Human Choroidal Melanoma Cells Mediates Cell Proliferation and Transformation through the MEK/ERK Pathway

Abstract

The BRAF gene, encoding a mitogen-activated protein kinase kinase kinase, is mutated in several human cancers, with the highest incidence occurring in cutaneous melanoma. The activating V599E mutation accounted for 80% of all mutations detected in cutaneous melanoma cell lines. Reconstitution experiments have shown that this mutation increases ectopically expressed B-Raf kinase activity and induces NIH3T3 cell transformation. Here we used tumor-derived cell lines to characterize the activity of endogenous mutated B-Raf protein and assess its specific role in transformation. We show that three cell lines (OCM-1, MKT-BR, and SP-6.5) derived from human choroidal melanoma, the most frequent primary ocular neoplasm in humans, express B-Raf containing the V599E mutation. These melanoma cells showed a 10-fold increase in endogenous B-Raf One of the main hallmarks of cancer is the acquisition by transformed cells of self-sufficiency in growth signals. In contrast, normal cells require mitogenic growth signals transmitted by transmembrane receptors to enter the cell cycle (1). The Raf/MEK 1 (MAPK or ERK kinase)/ERK (extracellular signalregulated kinase) module of the mitogen-activated protein kinase cascade is a major intracellular mediator of mitogenic signaling that regulates numerous biological processes (2, 3). Activation of this cascade downstream of membrane-bound receptors occurs through the interaction of Raf proteins with the small GTPase Ras upon its conversion to the GTP loaded, activated form. Mutations in genes encoding components of the Ras/Raf/MEK/ERK signaling pathway contribute to the development of many human cancers. Point mutations in HRAS, KRAS, and NRAS that lead to the constitutive activation of their protein products are found in ϳ30% of all human cancers (4), suggesting that the deregulation of downstream effectors of Ras is involved in oncogenesis. Although constitutive activation of ERK1/2 was detected in 36% of 50 studied human tumor cell lines (5), no mutations have been found in either ERK1/2 or MEK1/2 in human tumors. However, mutations in the BRAF gene were detected recently in ϳ20% of 530 human tumoral cell lines (6). B-Raf, the major MEK activator, has a higher affinity for and is a more efficient activator of MEK1 and MEK2 than Raf-1 (7-11). Two classes of BRAF gene mutation have been detected in the kinase domain of B-Raf; both of them lead to a constitutive increase in its kinase activity (6). One consists of single amino acid substitutions within the glycine-rich loop located in exon 11 of BRAF. These mutations are frequently associated with a RAS gene mutation. The other consists of single amino acid substitutions within the activation loop (exon 15 of BRAF). This class is never associated with a RAS gene mutation (6). B-Raf is more strongly activated by the second class of mutations, which may explain why the first class is always found associated with a RAS mutation. The highest incidence of BRAF mutations was found in cutaneous melanomas. Sixty-six percent of malignant cutaneous ...

Role of the pro-survival molecule Bfl-1 in melanoma

“…But within cancers, the over-activation of this MAPK pathway often results from mutations in the proto-oncogene Ras, or the activating mutation of B-Raf 204 . As discussed earlier, the MAPK pathway is observed to be hyperactivated in melanoma, but not in melanocytes 205 .…”

Mutant B-RAF signaling and cyclin D1 regulate Cks1/S-phase kinase-associated protein 2-mediated degradation of p27Kip1 in human melanoma cells

“…For B-RAF knockdowns, two siRNAs were used: B-RAF V600E (GA GAAAUCUCGAUGGAGUGGG) (Calipel et al, 2003) and B-RAF duplex #1 (ACAGAGACCUCAAGAGUAAUU). Cyclin D1 knockdowns were carried out with a SmartPool, as described previously (Bhatt et al, 2005).…”

Roles of Stem Cell Factor/c-Kit and Effects of Glivec®/STI571 in Human Uveal Melanoma Cell Tumorigenesis

“…We analyzed exons 9, 11, 13, and 17 of the human c-KIT gene, using specific PCR primers designed to amplify each exon plus its flanking intron sequences (Table I). The primers for amplification of exon 15 of the human BRAF gene have been described elsewhere (31). PCR amplification was carried out in a total volume of 25 l, containing 250 ng of genomic DNA, 0.5 M each primer, 0.2 mM each dNTP, 50 mM KCl, 20 mM Tris-HCl, pH 8.4, 1.5 mM MgCl 2 , and 1.25 IU of Platinium High Fidelity TaqDNA polymerase (Invitrogen).…”

“…Thus, an autocrine activation loop, involving the production and secretion of endogenous SCF, may be involved in the high rate of proliferation of 92.1, SP6.5, Mel270, and TP31 uveal melanoma cells. The lack of such an SCF/c-Kit autocrine activation loop for cell proliferation in the OCM-1 and MKT-BR cell lines may be accounted for by the presence of the V599E B-Raf activating mutation, which is involved in the acquisition of growth autonomy (31). The c-Kit-positive cell line SP6.5 also harbors the V599E B-Raf mutation.…”

“…Downstream intracellular signaling pathways, such as the MAPK or ERK kinase (MEK)/extracellular signal-regulated kinase (ERK) module, which controls growth, cell survival, and transformation, are deregulated (26). Few or no mutations have been found in the genes encoding proteins of the major intracellular signaling pathways controlling cell proliferation in human uveal melanomas, including those affected in cutaneous melanoma, with the exception of V599E B-Raf, for which mutations have been detected in a few uveal melanoma cell lines (27)(28)(29)(30)(31)(32)(33). Thus, the deregulation of growth factor signaling may be more important in uveal melanoma than in cutaneous melanoma tumorigenesis.…”