Mutation of Arg191 in FtsZ Impairs Cytokinetic Abscission of Bacillus subtilis Cells

Abstract

FtsZ monomers assemble to form a dynamic Z-ring at the midcell position in bacteria that coordinates bacterial cell division. Antibacterial agents plumbagin and SB-RA-2001 were found to bind to FtsZ and to inhibit Z-ring formation in bacteria. Docking analysis indicated similar binding regions for these two inhibitors on FtsZ, and residue R191 was involved in the binding interaction with both compounds. In this work, the importance of R191 in FtsZ assembly and in bacterial cell division was analyzed. R191A-FtsZ exhibited significantly poorer polymerization ability. Further, the mutant FtsZ could poison the assembly of wild-type FtsZ (WT-FtsZ). The expression of R191A-FtsZ in Bacillus subtilis strain PL2084 perturbed Z-ring formation and produced filamentous cells, indicating that the mutation hindered the division of these cells. The results suggested that the R191A mutation is a dominant negative mutation of FtsZ. Molecular dynamics simulations of R191A-FtsZ and WT-FtsZ revealed a kink in helices H5 and H7 in the active site of R191A-FtsZ compared to that of WT-FtsZ, which is required for FtsZ assembly. The findings suggested that R191 is an important residue for FtsZ assembly, which can be targeted for the design of FtsZ inhibitors.

Mechanistic insight into the effect of BT‐benzo‐29 on the Z‐ring in Bacillus subtilis

“…The resistance of V275A FtsZ to BT‐benzo‐29 was checked in B. subtilis cells expressing V275A FtsZ. The construction of mutant FtsZ (pHT01‐V275A ftsZ ) was done by site‐directed mutagenesis . The primers designed for the site‐directed mutagenesis were forward primer (5′CAGCCTATATGAAGCGCAGGAAGCAGCAG3′) and reverse primer (5′CTGCTGCTTCCTGCGCTTCATATAGGCTG3′).…”

“…The construction of mutant FtsZ (pHT01-V275A ftsZ) was done by site-directed mutagenesis. 29 The primers designed for the site-directed mutagenesis were forward primer (5 0 CAGCCTATATGA AGCGCAGGAAGCAGCAG3 0 ) and reverse primer (5 0 CT GCTGCTTCCTGCGCTTCATATAGGCTG3 0 ). The mutant amplicons were digested, ligated, and then transformed into E. coli DH5α strain.…”

Regulation of Streptococcus pneumoniae FtsZ assembly by divalent cations: paradoxical effects of Ca2+ on the nucleation and bundling of FtsZ polymers

“…Briefly, different concentrations (4, 6, 8, 10, 12, and 14 lM) of FtsZ were incubated in PK buffer at 25°C for 10 min. In addition, the moles of P i released per moles of polymeric FtsZ were also calculated as described previously [63]. An aliquot (40 lL) was withdrawn from each of the reaction mixtures at 15 min.…”

“…GTP (0.1 mM) was added to each of the reaction mixtures, and the amount of P i released was monitored at different time intervals (20,50,100,150,200, 250, and 300 s) at 37°C [62,63]. GTP (0.1 mM) was added to each of the reaction mixtures, and the amount of P i released was monitored at different time intervals (20,50,100,150,200, 250, and 300 s) at 37°C [62,63].…”

“…For determining the GTPase activity of FtsZ, the standard malachite green-ammonium molybdate assay was employed [62,63]. Briefly, different concentrations (4, 6, 8, 10, 12, and 14 lM) of FtsZ were incubated in PK buffer at 25°C for 10 min.…”