Mutation analysis of the tyrosine phosphatase PTPN2 in Hodgkin's lymphoma and T-cell non-Hodgkin's lymphoma

Kleppe, Maria; Tousseyn, Thomas; Geissinger, Eva; Atak, Zeynep Kalender; Aerts, Stein; Rosenwald, Andreas; Włodarska, Iwona; Cools, Jan

doi:10.3324/haematol.2011.041921

Cited by 60 publications

(49 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In hepatocellular carcinoma, loss of PTPN2 was correlated with presence of lymph node metastasis [36]. PTPN2 loss through gene deletions or mutations have been reported in T-cell acute lymphoblastic leukaemia (T-ALL) and peripheral T-cell lymphoma not otherwise specified, and has been coupled to increased cytokine sensitivity and proliferation through stimulation of the Janus kinase/signal transducers and activators of transcription (JAK/STAT) -signalling pathways [37][38][39]. There are few functional studies conducted on PTPN2 in breast cancer cells, however, in triple-negative breast cancers PTPN2 downregulation and subsequent upregulation of SFK (Src family of protein tyrosine kinases) and STAT3-signalling was detected [40,41].…”

Section: Discussionmentioning

confidence: 99%

Loss of protein tyrosine phosphatase, non-receptor type 2 is associated with activation of AKT and tamoxifen resistance in breast cancer

Karlsson

Veenstra

Emin

et al. 2015

Breast Cancer Res Treat

View full text Add to dashboard Cite

Gene copy loss of PTPN2 was detected in 16% (34/215) of the tumours and this was significantly correlated with lower levels of PTPN2 mRNA. PTPN2 gene loss and lower mRNA levels were associated with activation of AKT and a poor prognosis. Furthermore, PTPN2 gene loss was a significant predictive marker of poor benefit from tamoxifen treatment.In conclusion, genomic loss of PTPN2 may be a previously unknown mechanism of PI3K/AKT upregulation in breast cancer. PTPN2 status is a potential new clinical marker of endocrine treatment benefit which could guide further individualised therapies in breast cancer.

show abstract

Section: Discussionmentioning

confidence: 99%

Loss of protein tyrosine phosphatase, non-receptor type 2 is associated with activation of AKT and tamoxifen resistance in breast cancer

Karlsson

Veenstra

Emin

et al. 2015

Breast Cancer Res Treat

View full text Add to dashboard Cite

show abstract

“…Mutation analysis of cytokine signaling genes that did not emerge from WES in NMZL, but are known to be mutated in lymphomas, namely PTPN1, PTPN2, SOCS1, STAT3, STAT6, and JAK1, [15][16][17][18][19][20] as well as mutation analysis of PTPRD in EMZL and in the validation cohort of NMZL, were performed by Sanger sequencing. Details are in the supplemental Appendix.…”

Section: Sanger Sequencingmentioning

confidence: 99%

The Genetics of Nodal Marginal Zone Lymphoma

Spina

Khiabanian

Messina

et al. 2016

Clinical Lymphoma Myeloma and Leukemia

View full text Add to dashboard Cite

Key Points• PTPRD lesions are among the most recurrent alterations in NMZL and appear to be enriched in this lymphoma type across mature B-cell tumors.• NMZL and SMZL genetics overlap with the exceptions of PTPRD lesions, supporting their distinction as independent entities.Nodal marginal zone lymphoma (NMZL) is a rare, indolent B-cell tumor that is distinguished from splenic marginal zone lymphoma (SMZL) by the different pattern of dissemination. NMZL still lacks distinct markers and remains orphan of specific cancer gene lesions. By combining whole-exome sequencing, targeted sequencing of tumor-related genes, wholetranscriptome sequencing, and high-resolution single nucleotide polymorphism array analysis, we aimed at disclosing the pathways that are molecularly deregulated in NMZL and we compare the molecular profile of NMZL with that of SMZL. These analyses identified a distinctive pattern of nonsilent somatic lesions in NMZL. In 35 NMZL patients, 41 genes were found recurrently affected in ‡3 (9%) cases, including highly prevalent molecular lesions of MLL2 (also known as KMT2D; 34%), PTPRD (20%), NOTCH2 (20%), and KLF2 (17%).Mutations of PTPRD, a receptor-type protein tyrosine phosphatase regulating cell growth, were enriched in NMZL across mature B-cell tumors, functionally caused the loss of the phosphatase activity of PTPRD, and were associated with cell-cycle transcriptional program deregulation and increased proliferation index in NMZL. Although NMZL shared with SMZL a common mutation profile, NMZL harbored PTPRD lesions that were otherwise absent in SMZL. Collectively, these findings provide new insights into the genetics of NMZL, identify PTPRD lesions as a novel marker for this lymphoma across mature B-cell tumors, and support the distinction of NMZL as an independent clinicopathologic entity within the current lymphoma classification. (Blood. 2016;128(10):1362-1373

show abstract

“…16 Conversion of DiFMUP into DiFMU was monitored using a Victor X4 plate reader. Initial conversion rates were calculated from the slope of the linear curve of fluorescence versus time for each substrate concentration.…”

Section: Immunocomplex Phosphatase Activity Assaymentioning

confidence: 99%

Mutation of the receptor tyrosine phosphatase PTPRC (CD45) in T-cell acute lymphoblastic leukemia

Porcu

Kleppe

Gianfelici

et al. 2012

Blood

103

View full text Add to dashboard Cite

IntroductionT-cell acute lymphoblastic leukemia (T-ALL) is an aggressive malignancy characterized by the accumulation of undifferentiated thymocytes that have acquired multiple genomic aberrations affecting critical transcriptional and signaling pathways. 1,2 T-ALL is also frequently characterized by the expression of constitutively activated tyrosine kinases, such as ABL1, LCK, JAK1, and JAK3. [3][4][5][6][7] Recently identified mutations in the IL-7 receptor ␣ (IL-7R) and deletions of the tyrosine phosphatase PTPN2 were also reported to affect tyrosine kinase signaling. [8][9][10] The genetic and functional data presented in this work now identify the tyrosine phosphatase CD45 as a new tumor suppressor gene in T-ALL. CD45 is a transmembrane protein that is abundantly present on the surface of all nucleated hematopoietic cells. CD45 is encoded by the PTPRC gene and is known to regulate phosphorylation of SRC and JAK family kinases. 11-13 Methods Cell cultureHEK293T and human T-ALL cell lines were cultured in RPMI 1640 medium supplemented with FBS. MOHITO cells were cultured and transduced as described previously. 14 For dose-response curves, T-ALL cell lines were seeded out in triplicate in 24-well plates at a density of 5 ϫ 10 5 cells/mL and incubated for 48 hours with the JAK family kinase inhibitor INCB018424 (Chemietek). Viable cell numbers were determined using CellTiter 96 AQ ueous One Solution (Promega) and a Victor X4 plate reader (PerkinElmer Life and Analytical Sciences). Patient samples and sequence analysisPatient genomic DNA was collected at various institutions at time of diagnosis and remission. All samples were obtained according to the guidelines of the local ethics committees at KU Leuven, and informed consent was obtained from all subjects in accordance with the Declaration of Helsinki. All coding exons of PTPRC as well as exon 6 of IL-7R were amplified and PCR products were directly sequenced. ConstructsThe open reading frames of wild-type and mutant CD45R0 were cloned into pMSCV-Puro (Clontech). Retroviral vectors expressing nonsilencing or CD45 targeting shRNAs were obtained by cloning short hairpin RNA sequences into a pMSCV-GFP construct containing a mir30 flanking cassette. shRNA sequences: CTCGCTTGGGCGAGAGTAA (shControl) and AGCAGATGATATTCCAAAGAAA (shCD45). Western blottingThe following antibodies were used: anti-CD45 (clone 69; BD Biosciences); anti-phospho-JAK1 (Tyr1022/1023), anti-STAT5 (clone L-20; Santa Cruz Biotechnology); anti-JAK1 (clone73; Millipore); anti-phospho-STAT5 (Tyr694), anti-phospho-STAT3 (Tyr705), anti-STAT3 (79D7; Cell Signaling); anti-beta actin (Sigma-Aldrich). For personal use only. on March 24, 2019. by guest www.bloodjournal.org From Immunocomplex phosphatase activity assayDiFMUP immunocomplex phosphatase activity assay 15 was performed as described earlier. 16 Conversion of DiFMUP into DiFMU was monitored using a Victor X4 plate reader. Initial conversion rates were calculated from the slope of the linear curve of fluorescence versus time for each substrate c...

show abstract

Mutation analysis of the tyrosine phosphatase PTPN2 in Hodgkin's lymphoma and T-cell non-Hodgkin's lymphoma

Cited by 60 publications

References 16 publications

Loss of protein tyrosine phosphatase, non-receptor type 2 is associated with activation of AKT and tamoxifen resistance in breast cancer

Loss of protein tyrosine phosphatase, non-receptor type 2 is associated with activation of AKT and tamoxifen resistance in breast cancer

The Genetics of Nodal Marginal Zone Lymphoma

Mutation of the receptor tyrosine phosphatase PTPRC (CD45) in T-cell acute lymphoblastic leukemia

Contact Info

Product

Resources

About