Muscular dystrophy by merosin deficiency decreases acetylcholinesterase activity in thymus of Lama2dy mice

Abstract

Half of congenital muscular dystrophy cases arise from laminin a2 (merosin) deficiency, and merosin-deficient mice (Lama2dy) exhibit a dystrophic phenotype. The abnormal development of thymus in Lama2dy mice, the occurrence of acetylcholinesterase (AChE) in the gland and the impaired distribution of AChE molecules in skeletal muscle of the mouse mutant prompted us to compare the levels of AChE mRNAs and enzyme species in thymus of control and Lama2dy mice. AChE activity in normal thymus (mean ± SD 1.42 ± 0.28 lmol acetylthiocholine/h/mg protein, U/mg) was decreased by 50% in dystrophic thymus (0.77 ± 0.23 U/mg) (p ¼ 0.007), whereas butyrylcholinesterase activity was little affected. RT-PCR assays revealed variable levels of R, H and T AChE mRNAs in thymus, bone marrow and spinal cord.

Morphoregulation by acetylcholinesterase in fibroblasts and astrocytes

“…We performed reverse transcription‐polymerase chain reaction (RT‐PCR) on RNA isolated from 3T3 fibroblasts and neuroblastoma NB2a cells to determine whether AChE transcripts (‐T, ‐R, ‐H) are present in fibroblasts, and whether they express the neuronal AChE‐tethering peptides PRiMA‐I or PRiMA‐II (with long or short cytoplasmic domains respectively). Published primers were used for AChE isoforms (Nieto‐Ceron et al, 2005), PRiMA‐I and ‐II (Perrier et al, 2003), and control GADPH (Perrier et al, 2003), and the experiment was repeated several times. The representative gel in Figure 1E shows that 3T3 fibroblasts and neuroblastoma cells express both AChE‐T and PRiMA‐I (with the longer cytoplasmic domain, 233 bp band), but not PRiMA‐II (no 340 bp band).…”

“…To obtain cDNA, RNA was reverse‐transcribed using Omniscript reverse transcriptase (Qiagen, West Sussex, UK) with oligo‐dT primers (R&D Systems Europe Ltd., Abingdon, UK) for 60 min at 37°C, in a volume of 20 µL. PCR reactions were performed to detect expression of transcripts encoding AChE‐T, AChE‐R, AChE‐H, PRiMA (both I and II) and GADPH, and were carried out in 50 µl buffered medium containing 2 µl cDNA, AChE primers (0.3 µM), 25 µL PCR master mix (Fermentas UK, York, UK; Nieto‐Ceron et al, 2005). Reactions included an initial denaturing step of 2 min at 94°C, followed by 29 cycles with 20 sec at 94°C, 20 sec at 63°C, and 40 sec at 65°C.…”

“…PCR products were visualised with ethidium bromide in 1.5% agarose gels. Primers: AChE primers were those designed by Nieto‐Ceron et al (2005) to cover exon–exon splicing sites. The forward primer for all three was targeted to the common E3/E4 junction (ATTTTGCCCGCACAGGGGAC).…”

Cholinesterases are down-expressed in human colorectal carcinoma

“…The percentage of each AChE form was estimated by comparing the AChE activity under each peak area and under the entire profile. The distinct migration of ChE components depending on the detergent (Brij 96 or Triton X-100) added to sucrose gradients showed their amphiphilic properties, which were further confirmed using hydrophobic chromatography in phenyl-agarose [18,19]. The asymmetric structure of 16.2S AChE was assessed by cleaving its ColQ tail with collagenase [20].…”

Expression of cholinesterases in human kidney and its variation in renal cell carcinoma types

“…Acetylcholinesterase‐T forms homo‐oligomers, the so‐called ‘globular forms’ (G 1 , G 2 , and G 4 ), and hetero‐oligomers, depending on the lack or addition of structural subunits. Acetylcholinesterase‐H adds glycosylphosphatidylinositol (GPI) and forms amphiphilic monomers (G 1 A ) and dimers (G 2 A ) [14]. The stress‐inducible acetylcholinesterase‐R subunit can replace the T‐subunit in oligomers [11].…”