Multitrophic diversity in a biodiverse forest is highly nonlinear across spatial scales

Schuldt, Andreas; Wubet, Tesfaye; Buscot, François; Staab, Michael; Aßmann, Thorsten; Böhnke-Kammerlander, Martin; Both, Sabine; Erfmeier, Alexandra; Klein, Alexandra‐Maria; Ma, Keping; Pietsch, Katherina A.; Schultze, Sabrina; Wirth, Christian; Zhang, Jia‐Yong; Zumstein, Pascale; Bruelheide, Helge

doi:10.1038/ncomms10169

Cited by 43 publications

(66 citation statements)

References 64 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…We integrated published HTS molecular datasets for soil (Schuldt et al, ) and deadwood (Purahong et al, ) fungal communities derived from 27 comparative study plots (30 m × 30 m) located in the Gutianshan National Nature Reserve (GNNR, 81 km 2 , 29°08′–29°17′N, 118°27′–118°11′E), Zhejiang province, South‐East China, as part of the Biodiversity‐Ecosystem Functioning (BEF‐China) project (Bruelheide et al, ). The vegetation here is characterized as moist, mixed subtropical broadleaved forest with successional ages ranging from <20 to ≥80 years (Bruelheide et al, ).…”

Section: Methodsmentioning

confidence: 99%

“…For both sets of material, we used the same primer pairs (ITS1F [5′‐CTTGGTCATTTAGAGGAAGTAA‐3′] and ITS4 [5′‐TCCTCCGCTTATTGATATGC‐3′]) to amplify the entire fungal internal transcribed spacer (ITS) rRNA region (Gardes & Bruns, ; White, Bruns, Lee, & Taylor, ). The amplified fragments were then subjected to 454 pyrosequencing and bioinformatics analysis as described in detail by Purahong, Wubet, et al (), Purahong et al () and Schuldt et al (). We did a unidirectional sequencing of the amplicons from the ITS4 end (reverse primer), thus the fungal ITS2 sequences were used for further analysis.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Potential links between wood‐inhabiting and soil fungal communities: Evidence from high‐throughput sequencing

et al. 2019

Self Cite

View full text Add to dashboard Cite

Wood‐inhabiting fungi (WIF) are pivotal to wood decomposition, which in turn strongly influences nutrient dynamics in forest soils. However, their dispersal mechanisms remain unclear. We hypothesized that the majority of WIF are soil‐borne. For this reason, the presented research aimed to quantify the contribution of soil as a source and medium for the dispersal of WIF to deadwood using high‐throughput sequencing. We tested effects of tree species (specifically Schima superba and Pinus massoniana) on the percentage of WIF shared between soil and deadwood in a Chinese subtropical forest ecosystem. We also assessed the taxonomic and ecological functional group affiliations of the fungal community shared between soil and deadwood. Our results indicate that soil is a major route for WIF colonization as 12%–15% (depending on the tree species) of soil fungi were simultaneously detected in deadwood. We also demonstrate that tree species (p < 0.01) significantly shapes the composition of the shared soil and deadwood fungal community. The pH of decomposing wood was shown to significantly correspond (p < 0.01) with the shared community of wood‐inhabiting (of both studied tree species) and soil fungi. Furthermore, our data suggest that a wide range of fungal taxonomic (Rozellida, Zygomycota, Ascomycota, and Basidiomycota) and ecological functional groups (saprotrophs, ectomycorrhizal, mycoparasites, and plant pathogens) may use soil as a source and medium for transport to deadwood in subtropical forest ecosystem. While 12%–62% of saprotrophic, ectomycorrhizal, and mycoparasitic WIF may utilize soil to colonize deadwood, only 5% of the detected plant pathogens were detected in both soil and deadwood, implying that these fungi use other dispersal routes. Animal endosymbionts and lichenized WIF were not detected in the soil samples. Future studies should consider assessing the relative contributions of other possible dispersal mechanisms (e.g. wind, water splash, water dispersal, animal dispersal, and mycelial network) in the colonization of deadwood by soil fungi.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Potential links between wood‐inhabiting and soil fungal communities: Evidence from high‐throughput sequencing

et al. 2019

Self Cite

View full text Add to dashboard Cite

show abstract

“…Several studies have shown that with increasing forest-use intensity, local ( α -diversity) and total ( γ -diversity) species richness declined linearly, whereas species turnover between plots increased [18]. The forest-use intensity in the most intensively used plots led to sparse herb layer and reduced species richness [19].…”

Section: Introductionmentioning

confidence: 99%

Diversity and composition of herbaceous angiosperms along gradients of elevation and forest-use intensity

et al. 2017

View full text Add to dashboard Cite

Terrestrial herbs are important elements of tropical forests; however, there is a lack of research on their diversity patterns and how they respond to different intensities of forest-use. The aim of this study was to analyze the diversity of herbaceous angiosperms along gradients of elevation (50 m to 3500 m) and forest-use intensity on the eastern slopes of the Cofre de Perote, Veracruz, Mexico. We recorded the occurrence of all herbaceous angiosperm species within 120 plots of 20 m x 20 m each. The plots were located at eight study locations separated by ~500 m in elevation and within three different habitats that differ in forest-use intensity: old-growth, degraded, and secondary forest. We analyzed species richness and floristic composition of herb communities among different elevations and habitats. Of the 264 plant species recorded, 31 are endemic to Mexico. Both α- and γ-diversity display a hump-shaped relation to elevation peaking at 2500 m and 3000 m, respectively. The relative contribution of between-habitat β-diversity to γ-diversity also showed a unimodal hump whereas within-habitat β-diversity declined with elevation. Forest-use intensity did not affect α-diversity, but β-diversity was high between old-growth and secondary forests. Overall, γ-diversity peaked at 2500 m (72 species), driven mainly by high within- and among-habitat β-diversity. We infer that this belt is highly sensitive to anthropogenic disturbance and forest-use intensification. At 3100 m, high γ-diversity (50 species) was driven by high α- and within-habitat β-diversity. There, losing a specific forest area might be compensated if similar assemblages occur in nearby areas. The high β-diversity and endemism suggest that mixes of different habitats are needed to sustain high γ-richness of terrestrial herbs along this elevational gradient.

show abstract

“…The scale dependency of cross‐taxon congruence indicates that it is not advisable to use plants as a surrogate for foliar arthropod diversity beyond local scales (Schuldt et al. ).…”

Section: Discussionmentioning

confidence: 99%

Congruence between arthropod and plant diversity in a biodiversity hotspot largely driven by underlying abiotic factors

Schalkwyk

Pryke

Samways

et al. 2019

Ecological Applications

View full text Add to dashboard Cite

Plants often form the basis of conservation planning and management. The effectiveness of plant diversity as a surrogate for arthropod diversity was assessed in natural areas in the Kogelberg Biosphere Reserve, a floral endemism hotspot in the Cape Floristic Region (CFR), South Africa. Arthropods and plants were sampled across 30 topographically heterogeneous sites in a spatially nested design. The relationship between plants and arthropods were quantified in terms of species richness, assemblage variation, and assemblage turnover. The influence of arthropod trophic groups, habitat association, and spatial scale were also explored. Generalized dissimilarity modelling was used to investigate differential influence of explanatory groups (geology, disturbance, local site characteristics, refuge, mesoclimate, terrain) on arthropod and plant turnover. Congruence in assemblage variation was restricted to local scales, and only present between plants and those arthropods associated with the foliar component of the habitat. Weak congruence in species turnover was due to differences in the relative importance of explanatory groups, with different variables within each explanatory group being important, and similar variables predicting different turnover patterns. For both groups, variables related to geology and fire history were important for assemblage turnover. These variables are already incorporated in conservation planning and management for plant diversity across the CFR. Overall plant diversity was a weak surrogate for the arthropod groups included in this study, suggesting that as an alternative, environmental surrogates for arthropod diversity perform better.

show abstract

Multitrophic diversity in a biodiverse forest is highly nonlinear across spatial scales

Cited by 43 publications

References 64 publications

Potential links between wood‐inhabiting and soil fungal communities: Evidence from high‐throughput sequencing

Potential links between wood‐inhabiting and soil fungal communities: Evidence from high‐throughput sequencing

Diversity and composition of herbaceous angiosperms along gradients of elevation and forest-use intensity

Congruence between arthropod and plant diversity in a biodiversity hotspot largely driven by underlying abiotic factors

Contact Info

Product

Resources

About