MULTIPLEX SYBR® GREEN-REAL TIME PCR (qPCR) ASSAY FOR THE DETECTION AND DIFFERENTIATION OF Bartonella henselae AND Bartonella clarridgeiae IN CATS

Staggemeier, Rodrigo; Pilger, Diogo André; Spilki, Fernando Rosado; Cantarelli, Vlademir Vicente

doi:10.1590/s0036-46652014000200001

Cited by 21 publications

(22 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Despite the significant variations found in this study, all results were within reference values [29], even plasma proteins. Naturally-acquired bartonellosis in cats seems to cause mild or no clinical signs or hematological changes.…”

Section: Discussionsupporting

confidence: 47%

See 1 more Smart Citation

Bartonella spp. and hematological changes in privately owned domestic cats from Rio de Janeiro, Brazil

Souza

Almosny

Favacho

et al. 2017

J Infect Dev Ctries

View full text Add to dashboard Cite

Introduction: Bartonella infection in cats can represent a risk to owners, particularly today when considering the increase in cat populations and their role in human bartonellosis epidemiology. In the present study, we aimed to detect Bartonella spp. in blood samples from 163 asymptomatic privately-owned cats from the metropolitan area of Rio de Janeiro State, Brazil by using a conventional PCR test and also to evaluate the association between Bartonella spp. and hematological changes in positive cats. Methodology: PCR assays were performed targeting the Bartonella spp heat shock protein (htrA) gene and complete blood counts were also performed in all samples. Positive PCR samples were confirmed by the presence of two genes, citrate synthase (gltA) and RNA polymerase beta-subunit-encoding (rpoB). Results: A total of 74.85% (122/163) of the tested cats were positive for Bartonella spp and partial sequencing confirmed to be B. henselae. All hematological findings from the 163 cats tested (PCR-positive and negative), presented normal limits. Conclusions: This study demonstrates that B. henselae is present in almost 75% asymptomatic privately-owned domestic cats in the metropolitan region of Rio de Janeiro State, Brazil. Our results also show that hematological findings in Bartonella spp. infected cats are uncommon. In this scenario, the use of PCR as a diagnostic tool in feline Bartonella infections should be considered. Finally, these results also demonstrate the potential risk of Bartonella spp. infection in the human population of the metropolitan area of Rio de Janeiro State, Brazil.

show abstract

Section: Discussionsupporting

confidence: 47%

“…negative cats were asymptomatic; however we cannot exclude subclinical diseases such as feline immunodeficiency virus (FIV), feline leukemia virus (FeLV) or mycosis such as sporotrichosis. Results from recent study that searched the association between such diseases showed no associations [29].…”

Section: Discussionmentioning

confidence: 99%

Bartonella spp. and hematological changes in privately owned domestic cats from Rio de Janeiro, Brazil

Souza

Almosny

Favacho

et al. 2017

J Infect Dev Ctries

View full text Add to dashboard Cite

show abstract

“…DNA extractions for molecular tests were performed using the DNA Blood kit (A&A Biotechnology Gdańsk, Poland). The extracted DNA was subjected to PCR, performed with the primers targeting fragments of the citrate synthase gene: one generic forward primer (BART-LC-GEN-F: 5' -ATGGGTTTTGGTCATCGAGT -3'); one specie-specific reverse B. henselae, primer (BART-LC-HEN-R: 5'-AA ATCGACATTAGGGTAAAGTTTTT -3'); and one species specific reverse B. clarridgeiae primer (BART-LC-CLA-R: 5'-CAAGAAGTGGATCATCTTGG -3'), according to the method described by Staggemeter et al [9], with small modifications: an initial denaturation of 2 min at 95 °C, followed by 37 cycles consisting of denaturation at 96 °C for 60 s, annealing at 55 °C for 60 s and elongation at 72 °C for 90 s. Reaction mixture (50 μL) contained 100 μM of each dNTP, 1.6 mM of MgCl2, 0.25 μM of each primer, 2.5 U of Taq DNA polymerase, and 5 μL of DNA template. A negative control, consisting of distilled water, and positive control, consisting of extracted DNA from a blood sample known to contain B. henselae (obtained from Institute of Parasitology, Academy of Science, Kosice, Slovakia), were used in each PCR run.…”

Section: Methodsmentioning

confidence: 99%

Cats as a reservoir of Bartonella henselae for dogs

Mazurek¹,

Winiarczyk²,

Skrzypczak³

et al. 2019

Ann Agric Environ Med.

View full text Add to dashboard Cite

Bartonellosis is a disease affecting a variety of animals. Many Bartonella infections are zoonotic, including cat scratch disease. Within the genus Bartonella are 45 species, of which more than 10 can infect cats and dogs. Companion animals serve as reservoirs for several zoonotic species of Bartonella, and may also serve as sentinels for zoonotic Bartonella species harbored by wildlife. The aim of this study was to determine the frequency of the occurrence of Bartonella spp. DNA in dogs from households where cats with clinical bartonellosis were kept. The presence of DNA with 99-100% compliance of the nucleotide sequence with the sequence of the Bartonella DNA isolated from cats was demonstrated in the body of 10% of tested dogs. The results indicate that cats serve as a Bartonella reservoir for dogs, and the dogs can play the same role with regard to humans.

show abstract

“…A high Bartonella prevalence was detected in this study, compared to most other Bartonella sp. cat prevalence studies reported from Brazil (Table 2) (5,6,8,(27)(28)(29)(30)(31)(32)(33)(34)(35)(36)(37)(38). Discrepancy among studies may be related to differences in the analytical sensitivity of laboratory diagnostic methods used among different studies.…”

Section: Discussionmentioning

confidence: 99%

Improvement of Bartonella henselae DNA Detection in Cat Blood Samples by Combining Molecular and Culture Methods

et al. 2018

View full text Add to dashboard Cite

spp. are bacteria of worldwide distribution that cause asymptomatic to fatal infections in animals and humans. The most common zoonotic species is , for which cats are the major natural reservoir host. To better understand sp. diagnostic limitations, we determined the frequency of bloodstream infection in 112 cats by comparing and combining the results of multiple conventional and nested PCRs from blood and liquid culture samples. Using liquid culture conventional PCR, sp. DNA was amplified from 27.7% of samples (31/112) compared to 90.2% of samples (101/112) by combining nested PCR from blood and liquid culture, indicating that PCR testing of more than one type of sample provides better sensitivity than a standalone PCR and that bloodstream infection is very frequent among cats in southeastern Brazil. This study reinforces the need for multistep testing for sp. infection to prevent false-negative diagnostic results, even in reservoir hosts such as cats that typically maintain higher bacteremia levels.

show abstract

MULTIPLEX SYBR® GREEN-REAL TIME PCR (qPCR) ASSAY FOR THE DETECTION AND DIFFERENTIATION OF Bartonella henselae AND Bartonella clarridgeiae IN CATS

Cited by 21 publications

References 24 publications

Bartonella spp. and hematological changes in privately owned domestic cats from Rio de Janeiro, Brazil

Bartonella spp. and hematological changes in privately owned domestic cats from Rio de Janeiro, Brazil

Cats as a reservoir of Bartonella henselae for dogs

Improvement of Bartonella henselae DNA Detection in Cat Blood Samples by Combining Molecular and Culture Methods

Contact Info

Product

Resources

About