“…DNA extractions for molecular tests were performed using the DNA Blood kit (A&A Biotechnology Gdańsk, Poland). The extracted DNA was subjected to PCR, performed with the primers targeting fragments of the citrate synthase gene: one generic forward primer (BART-LC-GEN-F: 5' -ATGGGTTTTGGTCATCGAGT -3'); one specie-specific reverse B. henselae, primer (BART-LC-HEN-R: 5'-AA ATCGACATTAGGGTAAAGTTTTT -3'); and one species specific reverse B. clarridgeiae primer (BART-LC-CLA-R: 5'-CAAGAAGTGGATCATCTTGG -3'), according to the method described by Staggemeter et al [9], with small modifications: an initial denaturation of 2 min at 95 °C, followed by 37 cycles consisting of denaturation at 96 °C for 60 s, annealing at 55 °C for 60 s and elongation at 72 °C for 90 s. Reaction mixture (50 μL) contained 100 μM of each dNTP, 1.6 mM of MgCl2, 0.25 μM of each primer, 2.5 U of Taq DNA polymerase, and 5 μL of DNA template. A negative control, consisting of distilled water, and positive control, consisting of extracted DNA from a blood sample known to contain B. henselae (obtained from Institute of Parasitology, Academy of Science, Kosice, Slovakia), were used in each PCR run.…”