Multiplex real-time PCR for the detection and differentiation of equid herpesvirus 1 (EHV-1) and equid herpesvirus 4 (EHV-4)

Diallo, Ibrahim S.; Hewitson, Glen; Wright, Liam; Kelly, M A; Rodwell, B.J.; Corney, Bruce G.

doi:10.1016/j.vetmic.2007.02.004

Cited by 61 publications

(68 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The isolation of EHV-4 in 3 out of the 12 nasal swabs, which were from the three horses presenting with respiratory distress is significant and provides circumstantial evidence that EHV-4 may have been responsible for the respiratory disease. This is further supported by the fact that it was not recovered from the remaining 8 nasal discharges which were also EHV-4 real-time PCR negative, suggesting that there was no EHV-4 DNA present in those samples as the real-time PCR can detect at least 4 copy number of the target gene [14]. However, it is also possible that EHV-4 DNA was present in all samples but might have been degraded as suggested by the results of the EHV-4 real-time PCR for sample NS-4, where one duplicate gave a Ct value of 37 while the other duplicate gave a Ct value of 0.…”

Section: Discussionmentioning

confidence: 76%

“…EHV-4 real-time PCR -An EHV-4 real-time PCR targeting the glycoprotein B gene was used as described previously [14]. The EHV-2 PCR was derived from a method described by Telford et al [42].…”

Section: Polymerase Chain Reactionmentioning

confidence: 99%

“…It was also of interest to note that one of the samples had Ct values of 37 and 0 (sample was tested twice in duplicate). This suggested that there were low amounts of EHV-4 DNA in the sample as the limit of detection of the real-time PCR was set at Ct = 38 [14].…”

Section: Polymerase Chain Reactionmentioning

confidence: 99%

See 2 more Smart Citations

Equine herpesvirus infections in yearlings in South-East Queensland

et al. 2008

Self Cite

View full text Add to dashboard Cite

SummaryTwelve nasal swabs were collected from yearling horses with respiratory distress and tested for Equid herpesvirus 1 (EHV-1) and Equid herpesvirus 4 (EHV-4) by realtime PCR targeting the glycoprotein B gene. All samples were negative for EHV-1; however 3 were positive for EHV-4. When these samples were tested for EHV-2 and EHV-5 by PCR all samples were negative for EHV-2 and 11 were positive for EHV-5. All three samples that were positive for EHV-4 were also positive for EHV-5.These three samples gave a limited CPE in ED cells reminiscent of EHV-4 CPE.EHV-4 CPE was obvious after 3 days and was characterised by syncytia. None of the samples produced cytopathic effect (CPE) on African green monkey kidney (Vero) cells or hamster kidney (BSR) cells. Four of the samples, which were positive in the EHV-5 PCR, produced CPE on rabbit kidney (RK13) cells and equine dermis (ED) cells. EHV-5 CPE on both cell lines was slow and was apparent after four 7-day passages. On RK13 cells the CPE was characteristic of equid herpesvirus with the formation of syncytia. However in ED cells, the CPE was characterised by ringshaped syncytia.For the first time a case of equine respiratory disease involving dual infection with EHV-4 and EHV-5 has been reported in Queensland. This was shown by simultaneously isolating EHV-4 and EHV-5 from clinical samples. EHV5 was recovered from all samples except one, suggesting that EHV5 was more prevalent in young horses than EHV2.

show abstract

Section: Discussionmentioning

confidence: 76%

Section: Polymerase Chain Reactionmentioning

confidence: 99%

See 1 more Smart Citation

Equine herpesvirus infections in yearlings in South-East Queensland

et al. 2008

Self Cite

View full text Add to dashboard Cite

show abstract

“…PCR also was used by many workers (26 and 27). Some other workers used real time PCR for diagnostic purposes with same abovementioned sensitivity (28 and 29), targeting the gB gene of the EHV-1 (30 EHV-1 previously and carried latently the virus and the virus might be reactivated due to some stress factors. Such animals became carriers of active virus (4 and 18).…”

Section: Resultsmentioning

confidence: 99%

Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus

Al-Ajeeli¹

2018

Iraqijvm

View full text Add to dashboard Cite

SummaryEquine herpsvirus type1 was classified as a member of the subfamily Alphaherpesvirinae. It was reported to cause respiratory, reproductive and neurologic infection in horses. The reproductive form of the disease induces abortion in pregnant mare, while the neurologic form is associated with paralysis of infected horses. This study was designed for molecular detection of Equine herpsvirus type1 by polymerase chain reaction. Blood buffy coat samples were collected from 25 horses (Equus feruscaballus) and 25 donkeys (Equus asinus) admitted to local private veterinary clinics around Baghdad and Baaquba cities. DNA was extracted from such samples by the use of DNA extraction kit of COLLECTAGENE T .The samples were subjected to conventional PCR test using specific primers for gB gene of equine herepesvirus-1. Forward primer (F) (5' TAACTGAGATCT AACCGAC 3') and reverse primer (R) (CATATATAGCTATCACGTCC 3'). One buffy coat sample from aborted mare and one buffy coat sample from a donkey suffering from acute respiratory clinical signs were inoculated in mice to follow the fate of equine herepesvirus-1in nasal turbinates, cervical lymph nodes and lungs of these mice. The results showed that only 4 samples from horses and 2 samples from donkeys were positive to polymerase chain reaction. Experimentally infected mice did not show any clinical signs but they were positive to polymerase chain reaction, and the virus easily terminated, probably due to low dose of the virus and host specificity. It can be concluded that local horses and donkeys, somewhere have had infected with equine herepesvirus-1, and became latent carriers for the virus. Furthermore, microbiological and epidemiological studies on local Equine herpsvirus type1 and Equine herpsvirus type 4 are recommended.

show abstract

“…Classical PCR results were confirmed by real-time PCR following the method described by Diallo et al 2007. The primers used (Table 2) …”

Section: Ehv-type Specific Detectionmentioning

confidence: 99%

First report on equine herpesvirus type 4 isolation in Poland – evaluation of diagnostic tools

Ploszay¹,

Rola²,

Larska³

et al. 2013

Polish Journal of Veterinary Sciences

View full text Add to dashboard Cite

Upper respiratory tract infections are still a serious problem in breeding and racing horses. The most common virological factors are EHV1 and EHV4, which are both a major cause of secondary infections. High EHV4 seroprevalence in Polish horses indicates a high transmission rate of this pathogen among horses and increases the need for proper diagnostics. The aim of this study was to develop a reliable laboratory diagnostic scheme for upper respiratory tract infections and to describe the first isolation of EHV4 in Poland. Twenty one nasal swabs collected from young horses under the age of 2 years showing clinical signs of equine rhinopneumonitis were tested with duplex PCR for simultaneous detection and differentiation between EHV1/EHV4. Positive samples were then subjected to virus isolation in Vero cells. Additionally, real-time PCR was developed which allowed viral copy numbers to be quantified and enabled defining that a DNA load below 10 3 copies per 1 ml of the sample reflected latent infection or decline of the disease. However, the sensitivity of traditional PCR proved to be sufficient in the diagnostic of the lytic infections and allowed identification of 10 EHV4 infected horses from which 3 strains were successfully isolated in cell culture. Another four EHV4 positive results were obtained by real-time PCR; but, a high Ct (threshold cycle) and a low virus DNA copy number suggested a latent infection. This report describes the first successful isolation of EHV4 from Polish horses.

show abstract

Multiplex real-time PCR for the detection and differentiation of equid herpesvirus 1 (EHV-1) and equid herpesvirus 4 (EHV-4)

Cited by 61 publications

References 37 publications

Equine herpesvirus infections in yearlings in South-East Queensland

Equine herpesvirus infections in yearlings in South-East Queensland

Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus

First report on equine herpesvirus type 4 isolation in Poland – evaluation of diagnostic tools

Contact Info

Product

Resources

About