Multiplex-PCR Method for Species Identification of Coagulase-Positive Staphylococci

Abstract

In veterinary medicine, coagulase-positive staphylococci (CoPS) other than Staphylococcus aureus have frequently been misidentified as being S. aureus strains, as they have several phenotypic traits in common. There has been no reliable method to distinguish among CoPS species in veterinary clinical laboratories. In the present study, we sequenced the thermonuclease (nuc) genes of staphylococcal species and devised a multiplex-PCR (M-PCR) method for species identification of CoPS by targeting the nuc gene locus. To evaluate sensitivity and specificity, we used this M-PCR method on 374 staphylococcal strains that had been previously identified to the species level by an hsp60 sequencing approach. We could successfully distinguish between S. aureus, S. hyicus, S. schleiferi, S. intermedius, S. pseudintermedius, and S. delphini groups A and B. The present method was both sensitive (99.8%) and specific (100%). Our M-PCR assay will allow the routine species identification of CoPS isolates from various animal species for clinical veterinary diagnosis.

Frequency and antimicrobial susceptibility of Staphylococcus pseudintermedius in dogs with otitis externa

“…Strains identified as belonging to the Staphylococcus genus were subjected to polymerase chain reaction (PCR) to amplify a 430-bp portion of the nuc gene locus to confirm their identity as S. pseudintermedius (SASAKI et al, 2010). Primers used for this analysis were: inF 5'CATGTCATATTATTGCGAATGA3', and inR3 5' AGGACCATCACCATTGACATATTGAAACC3'.…”

Prevalence and in vitro susceptibility of methicillin-resistant Staphylococcus pseudintermedius (MRSP) from skin and nostrils of dogs with superficial pyoderma

“…After classification as Staphylococcus sp., Voges-Proskauer, fermentation of carbohydrates (mannitol, sucrose, and trehalose), urease production, and polymyxin B sensitivity tests were performed to differentiate SIG from other species. After isolation, all coccoid bacteria samples were identified using molecular methods, with specific primers for S. pseudintermedius, as previously described (Sasaki et al 2010).…”

Detección del gen mecA en cepas de Staphylococcus coagulasa positiva aisladas desde gatos

“…Debido a que el kit BBL Crystal ® para Gram positivos utilizado en este estudio no es capaz de diferenciar entre dichas especies 40 , no fue posible diferenciar la presencia de S. pseudintermedius en los gatos muestreados, asumiéndose que los aislados identificados como S. intermedius corresponderían a S. pseudintermedius. Para ayudar a diferenciar ambas especies, pueden ser realizadas caracterizaciones moleculares como RFLP-RPC y RPC multiplex 5,41 . Por otra parte, el aislamiento de cepas de SCP desde gatos sanos ha sido reportado en diversos estudios 31,42 , y también desde lesiones cutáneas de éstos 31, 43 .…”