Multiple origins of deep-sea Asellota (Crustacea: Isopoda) from shallow waters revealed by molecular data

Abstract

The Asellota are a highly variable group of Isopoda with many species in freshwater and marine shallowwater environments. However, in the deep sea, they show their most impressive radiation with a broad range of astonishing morphological adaptations and bizarre body forms. Nevertheless, the evolution and phylogeny of the deep-sea Asellota are poorly known because of difficulties in scoring morphological characters. In this study, the molecular phylogeny of the Asellota is evaluated for 15 marine shallowwater species and 101 deep-sea species, using complete 18S and partial 28S rDNA gene sequences. Our molecular data support the monophyly of most deep-sea families and give evidence for a multiple colonization of the deep sea by at least four major lineages of asellote isopods. According to our molecular data, one of these lineages indicates an impressive radiation in the deep sea. Furthermore, the present study rejects the monophyly of the family Janiridae, a group of plesiomorphic shallow-water Asellota, and several shallow-water and deep-sea genera (Acanthaspidia, Ianthopsis, Haploniscus, Echinozone, Eurycope, Munnopsurus and Syneurycope).

Cryptic mitochondrial lineages in the widespread pycnogonid Colossendeis megalonyx Hoek, 1881 from Antarctic and Subantarctic waters

“…Indeed, the absence of eyes is a typical feature also of other deep-sea arthropod species (Raupach et al 2009). Presumably, eyes have been lost due to the lack of selective advantage in the dark environment.…”

A morphological and genetic description of pentastomid infective nymphs belonging to the family Sebekidae Sambon, 1922 in fish in Australian waters

“…Mitochondrial DNA was amplified from a partial region of the cytochrome oxidase 1 (cox1) gene between primers jgH-CO2198 (5'TITCIACIAAYCAYAARGAYATTGG) and jgL-CO1490 (5'TAIACYTCIGGRTGICCRAARAAYCA) (Geller et al 2013). The nuclear ribosomal DNA small subunit, 18S, was amplified and sequenced using primers 18S_1F (5'TACCTG-GTTGATCCTGCCAGT) modified from Raupach et al (2009), 18S_1000F (5'CGATCAGATACCGCCCTAGTTC) (Dreyer and Wagele 2001) and 18S_1800R (GATCCTTCCGCAGGT-TCACCTACG) (Raupach et al 2009). The nuclear ribosomal large subunit, 28S, was amplified and sequenced using primers 28S_22F (5'GWRRYWACCCGCTGAAYTWAAGC) (designed by authors) and 28S_1300R (5'CTGGCGATCGATTTGCACGT-CAG) (modified from Sonnenberg et al 2007).…”

Are there widespread peracarid species in the deep sea (Crustacea: Malacostraca)?

“…Wilson et al 2007;Raupach et al 2007Raupach et al , 2009Vogler et al 2008). On the contrary, genetic analyses have also revealed the existence of truly cosmopolitan species in some planktotrophic taxa (Meyer et al 2008) and also peracarid brooders (C. Held pers.…”