Mule determines the apoptotic response to HDAC inhibitors by targeted ubiquitination and destruction of HDAC2

Zhang, Jing; Kan, Shu; Huang, Brian; Zhou, Hao; Mak, Tak W.; Zhong, Qing

doi:10.1101/gad.170605.111

Cited by 48 publications

(45 citation statements)

References 58 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Huwe1 affects the stability of several transcription factors, including N-Myc (19), c-Myc (28), p53 (29), Mcl-1 (30), Cdc6 (31), and MyoD (32) as well as tumor suppressor, BRCA1 (33), DNA polymerase (34), and histone deacetylase, HDAC2 (35). REST ubiquitylation and inactivation mediated by E3 ligase ␤-TRCP is essential for the differentiation of neurons (36).…”

Section: Discussionmentioning

confidence: 99%

Destabilization of Atoh1 by E3 Ubiquitin Ligase Huwe1 and Casein Kinase 1 Is Essential for Normal Sensory Hair Cell Development

Tong

2016

Journal of Biological Chemistry

View full text Add to dashboard Cite

Proneural basic helix-loop-helix transcription factor, Atoh1, plays a key role in the development of sensory hair cells. We show here that the level of Atoh1 must be accurately controlled by degradation of the protein in addition to the regulation of Atoh1 gene expression to achieve normal cellular patterning during development of the cochlear sensory epithelium. The stability of Atoh1 was regulated by the ubiquitin proteasome system through the action of Huwe1, a HECT-domain, E3 ubiquitin ligase. An interaction between Huwe1 and Atoh1 could be visualized by a proximity ligation assay and was confirmed by co-immunoprecipitation and mass spectrometry. Transfer of a lysine 48-linked polyubiquitin chain to Atoh1 by Huwe1 could be demonstrated both in intact cells and in a cell-free system, and proteasome inhibition or Huwe1 silencing increased Atoh1 levels. The interaction with Huwe1 and polyubiquitylation were blocked by disruption of casein kinase 1 (CK1) activity, and mass spectrometry and mutational analysis identified serine 334 as an important phosphorylation site for Atoh1 ubiquitylation and subsequent degradation. Phosphorylation by CK1 thus targeted the protein for degradation. Development of an extra row of inner hair cells in the cochlea and an approximate doubling in the number of afferent synapses was observed after embryonic or early postnatal deletion of Huwe1 in cochlear-supporting cells, and hair cells died in the early postnatal period when Huwe1 was knocked out in the developing cochlea. These data indicate that the regulation of Atoh1 by the ubiquitin proteasome pathway is necessary for hair cell fate determination and survival.Loss of mammalian cochlear hair cells, caused by genetic mutations, autoimmune disease, ototoxic medications, exposure to noise, and aging, is usually permanent. Mammals show limited ability to regenerate hair cells (1, 2). Hair cell differentiation is dependent on basic helix-loop-helix (bHLH; transcription factor, Atoh1 (3, 4). Overexpression of Atoh1 via gene transfer results in the generation of new hair cells from inner ear progenitors in the organ of Corti (5).Increasing information about the transcriptional regulation of the Atoh1 gene has shown that expression of Atoh1 is regulated strictly by overlapping pathways (6 -10). We were interested in the downstream regulation of Atoh1 because of the importance of Atoh1 levels for its function in cells of the ear. Posttranslational control of Atoh1 is largely unknown. The ubiquitin-proteasome pathway plays an important role in posttranslational regulation of proteins in eukaryotic cells (11). The system not only degrades misfolded or damaged proteins but is also essential for the regulation of cell-signaling pathways, determining the half-lives of proteins (12). Cells utilize spatial distribution of ubiquitin conjugation to regulate local abundance of proteins and compartmentalization of different subcellular domains.E3 ubiquitin ligases transfer ubiquitin to internal lysine residues of specific proteins to form mono-or ...

show abstract

Section: Discussionmentioning

confidence: 99%

Destabilization of Atoh1 by E3 Ubiquitin Ligase Huwe1 and Casein Kinase 1 Is Essential for Normal Sensory Hair Cell Development

Tong

2016

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…Primers for Mef-2C and GAPDH (endogenous control) were custom-ordered from IDT for the following sequences: ACTTCCTGGAGAAGCAGAAAGGCA (forward) and AACACGTTTCCTTCTTCAGCACGC (reverse) for Mef-2C and TCAACAGCAACTCCCACTCTTCCA (forward) and ACCCTGT-TGCTGTAGCCGTATTCA (reverse) for GAPDH. These primers have been previously used to measure GAPDH and Mef-2C mRNA levels (9,43). iQ SYBR green supermix (Bio-Rad) and primers were combined with cDNA and placed into the MyiQ single-color real-time PCR detection system for PCR analysis.…”

Section: Methodsmentioning

confidence: 99%

Conditions that promote primary human skeletal myoblast culture and muscle differentiation in vitro

Cheng

El-Abd

Bui

et al. 2014

American Journal of Physiology-Cell Physiology

View full text Add to dashboard Cite

Conditions under which skeletal myoblasts are cultured in vitro are critical to growth and differentiation of these cells into mature skeletal myofibers. We examined several culture conditions that promoted human skeletal myoblast (HSkM) culture and examined the effect of microRNAs and mechanical stimulation on differentiation. Culture conditions for HSkM are different from those that enable rapid C2C12 myoblast differentiation. Culture on a growth factor-reduced Matrigel (GFR-MG)-coated surface in 2% equine serum-supplemented differentiation medium to promote HSkM differentiation under static conditions was compared with culture conditions used for C2C12 cell differentiation. Such conditions led to a Ͼ20-fold increase in myogenic miR-1, miR-133a, and miR-206 expression, a Ͼ2-fold increase in myogenic transcription factor Mef-2C expression, and an increase in sarcomeric ␣-actinin protein. Imposing Ϯ10% cyclic stretch at 0.5 Hz for 1 h followed by 5 h of rest over 2 wk produced a Ͼ20% increase in miR-1, miR-133a, and miR-206 expression in 8% equine serum and a Ͼ35% decrease in 2% equine serum relative to static conditions. HSkM differentiation was accelerated in vitro by inhibition of proliferationpromoting miR-133a: immunofluorescence for sarcomeric ␣-actinin exhibited accelerated development of striations compared with the corresponding negative control, and Western blotting showed 30% more ␣-actinin at day 6 postdifferentiation. This study showed that 100 g/ml GFR-MG coating and 2% equine serum-supplemented differentiation medium enhanced HSkM differentiation and myogenic miR expression and that addition of antisense miR-133a alone can accelerate primary human skeletal muscle differentiation in vitro. skeletal muscle; microRNA; myogenesis; differentiation; tissue engineering THE DYNAMICS OF PRIMARY HUMAN skeletal myoblast (HSkM) growth and differentiation into mature myofibers are critical to their use for applications in regenerative medicine, such as repair of severe muscle injuries, congenital defects, and muscular dystrophy. Most studies have focused on rodent myoblasts, and the bulk of the research has been carried out with the widely used immortalized murine C2C12 myoblast line, which is used for ease of culture, differentiation potential, and accessibility (7). Culture conditions for these cells have been optimized to ensure rapid growth and effective differentiation in vitro. These cells do not require protein-coated substrates and differentiate well in a range of equine serum-supplemented differentiation media (DM) (14,24,28,29,32). While C2C12 cells have provided invaluable information about key mechanistic steps in differentiation (31), extensive in vitro cultivation may lead to deviations from normal biological processes that are important for differentiation of myoblasts in a normal in vivo environment. Less is known about the dynamics of key differentiation factors in primary human myoblasts and how culture conditions affect the changes in these factors (3).In vitro, rodent myoblast differentiati...

show abstract

“…Conditional loss of HUWE1 in the mouse brain leads to an aberrant increase in n-MYC protein levels, inhibition of neuronal progenitor cell differentiation to mature neurons and glial cells, and neonatal death (38 -40). HUWE1 also regulates proteins with important roles in cell stress response pathways such as MCL-1, TP53, c-MYC, HDAC2, and MFN2 (41)(42)(43)(44)(45). Not surprisingly, because of its involvement in regulating oncogenes and neurogenesis, various lines of evidence implicate HUWE1 in human disease.…”

mentioning

confidence: 99%

Quantitative Lys-ϵ-Gly-Gly (diGly) Proteomics Coupled with Inducible RNAi Reveals Ubiquitin-mediated Proteolysis of DNA Damage-inducible Transcript 4 (DDIT4) by the E3 Ligase HUWE1

Thompson

Nagel

Hoving

et al. 2014

Journal of Biological Chemistry

View full text Add to dashboard Cite

Background: HUWE1 is an E3 ligase implicated in cancer and intellectual disabilities. Results: Inducible RNAi combined with quantitative diGly proteomics was implemented to find HUWE1 substrates. Conclusion: DDIT4 is a substrate of HUWE1. Significance: HUWE1 is a master regulator of cell stress response proteins including DDIT4. Inducible RNAi coupled with diGly proteomics is a valuable strategy for identifying novel E3 ligase substrates.

show abstract

Mule determines the apoptotic response to HDAC inhibitors by targeted ubiquitination and destruction of HDAC2

Cited by 48 publications

References 58 publications

Destabilization of Atoh1 by E3 Ubiquitin Ligase Huwe1 and Casein Kinase 1 Is Essential for Normal Sensory Hair Cell Development

Destabilization of Atoh1 by E3 Ubiquitin Ligase Huwe1 and Casein Kinase 1 Is Essential for Normal Sensory Hair Cell Development

Conditions that promote primary human skeletal myoblast culture and muscle differentiation in vitro

Quantitative Lys-ϵ-Gly-Gly (diGly) Proteomics Coupled with Inducible RNAi Reveals Ubiquitin-mediated Proteolysis of DNA Damage-inducible Transcript 4 (DDIT4) by the E3 Ligase HUWE1

Contact Info

Product

Resources

About