Mucinous differentiation features associated with hormonal escape in a human prostate cancer xenograft

Abstract

Many theories mention hypersensitive, promiscuous, outlaw or bypass signalling pathways to explain the acquisition of hormone independence in prostate cancer. Hormonal escape of prostate tumours is marked by many biological changes, including mucinous and neuroendocrine differentiation. Since expression of several mucins has been linked to carcinoma tumour progression, we have characterised the expression of mucins at both RNA and protein levels in an in vivo model of prostate cancer in hormonal escape. Using PAC120, a xenograft of a human hormone-dependent prostate tumour, and its hormone-independent variants, we analysed the expression of mucins (MUC1, MUC2, MUC4, MUC5AC, MUC5B, MUC6) by immunohistochemistry or reverse transcriptase (RT) -PCR. While the parental PAC120 tumour was a compact poorly-differentiated tumour of Gleason score 9 (5 þ 4), hormoneindependent variants displayed mucinous, neuroendocrine-like or mixed histological changes; these changes were stable through serial transplantations or after testosterone supply. MUC1 mRNA was expressed in both PAC120 and the hormone-independent variants, although at variable levels. All tumours displayed a high and constant expression of MUC2 and no expression of MUC4 mRNA. While MUC1 was expressed in all xenografts whatever their hormone dependence status, MUC2, MUC5B and MUC6 were preferentially expressed in hormone-independent variants. The loss of hormone dependence in this prostate cancer xenograft model is therefore marked by irreversible histological alterations, mucinous or neuro-endocrine, associated with an expression of secretory MUC2, MUC5B and MUC6, independent of the histological differentiation subtype. These data point to mucinous differentiation as an important step in the acquisition of hormone independence in this cancer, and suggest that secretory mucins might participate in an unknown pathway of hormonal escape in prostate cancer.

Potentiation of antitumour activity of docetaxel by combination with trastuzumab in a human prostate cancer xenograft model and underlying mechanisms

“…Alteration of tumour histology after docetaxel or docetaxel/trastuzumab combination treatment PAC120 and HID28 are high-grade adenocarcinomas that display similar differentiation with rare glandular structures, whereas HID25 is mucinous as previously described (Legrier et al, 2004) (Figure 2A, D and G). Mitoses were numerous in all tumours (mitotic index was 21, 8 and 11% in PAC120, HID25 and HID28, respectively).…”

“…Reverse transcription of RNA was performed by random priming (cDNA cycle Kit, Invitrogen) using 2 mg of total RNA. Real-time RT -PCR and the design of primers were as described (Legrier et al, 2004). Primers designed with the Primer Express software (ABI, Les Ulis, France) were the following: AR: S: CTTGTGTCAAAAGCGAAATGGGC, AS: CA AAACATGGTCCCTGGCAGTC; HER2: S: TGGAGACCCGCTGAA CAATAC, AS: CCTTTCAAGATCTCTGTGAGGCTT; HPRT: S: GCTTTCCTTGGTCAGGCAGTATAA, AS: AAGGGCATATCCTA CAACAAACTT.…”

Aberrant expression of transmembrane mucins, MUC1 and MUC4, in human prostate carcinomas

“…There are reports on the dysregulated mucin gene expression in prostate cancer [32,33]. In previous studies, we have shown that MUC4 is aberrantly expressed in pancreatic cancer and pancreatic intraepithelial neoplastic lesions (PanINs), and its expression correlates with the disease progression [21,25].…”

MUC1, MUC2, MUC4, MUC5AC and MUC6 Expression in the Progression of Prostate Cancer

“…However, in cancer cells and during progression, the mucin molecule becomes altered. Recently, it was reported that mucinous differentiation features are associated with hormonal escape in a human CaP xenograft model [3]. Mucins have also been implicated in the pathogenesis of benign and malignant diseases of secretory epithelial cells.…”