MtDNA variability in whitefly (Bemisia tabaci) populations in Brazil

Abstract

ABSTRACT. Bemisia tabaci (Hemiptera: Aleyrodidae) consists of a complex of morphologically indistinct biotypes that vary mainly in their capacity to transmit plant viruses and to induce physiological disorders in plants of economic importance. The adaptability of B. tabaci to many regions of the world has fostered the appearance of various biotypes and has resulted in a broad spectrum of host plants. Our goal was to identify which biotypes were present in four B. tabaci populations in Brazil. We quantified genetic variability between and within populations. Three individuals were collected from three host plant species: two populations on soybean (Campinas and Rondonópolis), one on pumpkin (Barreiras) and one on tomato (Cruz das Almas) in three States of Brazil (São Paulo, Mato Grosso, and Bahia). We chose one sequence of the B biotype, obtained from GenBank; the Campinas population, which had been previously characterized as biotype B, was used as a control for this biotype. We also included one sequence of the Q biotype, obtained from GenBank, as an outgroup. The COI region of the mtDNA gene was partially amplified with the CI-J-2195 and L2-N-3014 pair of primers, and the reaction products were sequenced. Based on distance- based algorithm analyses, we found that all haplotypes belong to biotype B, which was confirmed by the haplotype network. Genetic structure analyses showed that the host plant species does not influence population structuring of this pest; only the geographic location mattered.

Reproduction of the whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) B biotype in maize fields (Zea mays L.) in Brazil

“…DNA was purified from single female adults, according to Valle et al A fragment of the mitochondrial cytochrome oxidase I (Mt COI) gene (∼700 bp), previously established and widely used as a phylogeographic molecular marker to distinguish haplotypes of B. tabaci , was amplified by polymerase chain reaction (PCR) amplification using the primers C1‐J‐2195 (5′‐TTGATTTTTTGGTCATCCAGAAGT‐3′) and L2‐N‐3014 (5′‐TCCAATGCACTAATCTGCCATATTA‐3′) . The PCR amplification reactions were performed in a 25 µL volume using the Multiplex PCR kit (Qiagen, Valencia, CA).…”

Performance of Bemisia tabaci (Genn.) Biotype B (Hemiptera: Aleyrodidae) on Weeds

“…After a few generations, adults were sent to Dr. Judith K. Brown, University of Arizona, USA, who identified them as B. tabaci biotype B. Recently, adults of the colony were molecularly characterized and confirmed to belong to biotype B (Valle et al 2012b).…”

What Is the Spatial Extent of a Bemisia tabaci Population?

“…Sequence data from the mitochondrial gene cytochrome oxidase I (COI) has been used to delineate cryptic species [12], detect invasions and displacement of indigenous species [27,41,42,45,49], describe population size changes [45], and characterize levels of genetic diversity within species [13,41,44,53]. Perhaps unsurprisingly, COI-based studies typically report low levels of genetic diversity among invasive populations of MEAM 1 and MED, with MEAM 1 populations often comprising a single haplotype across entire regions [13,27,56,72].…”

“…These studies are global in coverage, focus largely on populations of MEAM 1 and MED, and span collections from 1991−2018 ( Figure 1, Table S1). Studies leverage a variety of genetic marker types [27,[39][40][41][42][43][44][45][46][47][48][49][50][51][52][53], but, while the majority use microsatellites [13,16,17,[54][55][56][57][58][59][60][61][62][63][64][65][66][67][68], use of single nucleotide polymorphisms is beginning to become more common [15,[69][70][71] (Figure 1). We organize our synthesis around insights gained from three common marker types (cytochrome oxidase I, microsatellites, single nucleotide polymorphisms) and associated measures of genetic diversity and differentiation, interpreting emergent patterns in light of potential underlying ecological and evolutionary processes.…”