mRNA stability and plasmid copy number effects on gene expression from an inducible promoter system

Carrier, Trent A.; Jones, Kristala L.; Keasling, Jay D.

doi:10.1002/(sici)1097-0290(19980920)59:6<666::aid-bit2>3.0.co;2-d

Cited by 56 publications

(28 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…However cells lacking this essential cya A gene show severely retarded growth, as was observed in other studies (14). Subsequent efforts focused on methods such as modifying mRNA stability via RNA hairpins (9) and verifying plasmid copy number (30). We decided the simplest way to achieve our goal was to modify the S.D.…”

Section: Discussionmentioning

confidence: 99%

“…To construct plasmid pBAD-ccdB, the ccdB gene was amplified from pTCKJ02 (9) (a gift from J. D. Keasling) with primer NheI-ccdB, catgca gctagc GGAGTG aaacgatgcagttt aaggtttacacctataaaaga (NheI site shown in italic), and ccdB-R(X+S), agtacg gcatgc cgtatg tctaga ttatattccccaaaacatcaggttaat (XbaI and SphI sites shown in italic), and cloned into the NheI and SphI sites of pBAD18 (10) (a gift from J. M. Slauch). Primer NheI-ccdB also contains the Shine-Dalgarno (S.D.)…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

A highly sensitive selection method for directed evolution of homing endonucleases

Chen

Zhao²

2005

Nucleic Acids Research

193

View full text Add to dashboard Cite

Homing endonucleases are enzymes that catalyze DNA sequence specific double-strand breaks and can significantly stimulate homologous recombination at these breaks. These enzymes have great potential for applications such as gene correction in gene therapy or gene alteration in systems biology and metabolic engineering. However, homing endonucleases have a limited natural repertoire of target sequences, which severely hamper their applications. Here we report the development of a highly sensitive selection method for the directed evolution of homing endonucleases that couples enzymatic DNA cleavage with the survival of host cells. Using I-SceI as a model homing endonuclease, we have demonstrated that cells with wild-type I-SceI showed a high cell survival rate of 80–100% in the presence of the original I-SceI recognition site, whereas cells without I-SceI showed a survival rate <0.003%. This system should also be readily applicable for directed evolution of other DNA cleavage enzymes.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

A highly sensitive selection method for directed evolution of homing endonucleases

Chen

Zhao²

2005

Nucleic Acids Research

193

View full text Add to dashboard Cite

show abstract

“…Cell cultures were centrifuged at 17,000 ϫ g for 2 min. The culture supernatant was filtered with 0.22-m-pore-size syringe filters, diluted in 10% HNO 3 , and analyzed for cadmium content on a PerkinElmer Optima 3000DV inductively coupled plasma spectrometer.…”

Section: Methodsmentioning

confidence: 99%

Metabolic Engineering of an Aerobic Sulfate Reduction Pathway and Its Application to Precipitation of Cadmium on the Cell Surface

Wang

Maratukulam

Lum

et al. 2000

Appl Environ Microbiol

Self Cite

View full text Add to dashboard Cite

The conversion of sulfate to an excess of free sulfide requires stringent reductive conditions. Dissimilatory sulfate reduction is used in nature by sulfate-reducing bacteria for respiration and results in the conversion of sulfate to sulfide. However, this dissimilatory sulfate reduction pathway is inhibited by oxygen and is thus limited to anaerobic environments. As an alternative, we have metabolically engineered a novel aerobic sulfate reduction pathway for the secretion of sulfides. The assimilatory sulfate reduction pathway was redirected to overproduce cysteine, and excess cysteine was converted to sulfide by cysteine desulfhydrase. As a potential application for this pathway, a bacterium was engineered with this pathway and was used to aerobically precipitate cadmium as cadmium sulfide, which was deposited on the cell surface. To maximize sulfide production and cadmium precipitation, the production of cysteine desulfhydrase was modulated to achieve an optimal balance between the production and degradation of cysteine.Dissimilatory reduction of sulfate to hydrogen sulfide is used by a diverse group of heterotrophic strict anaerobes as a sink for electrons generated during oxidation of a carbon source (2). Industrially, this source of sulfide has been used to precipitate metals in wastewater treatment reactors and has been proposed for stabilization of metals in soils and for formation of metal sulfide "quantum" particles for microelectronics applications (10). For removal of heavy metals from wastewater, addition of hydrogen sulfide (biologically or nonbiologically) can be especially effective because the metal sulfide precipitates are extremely insoluble and stable (14). Biological hydrogen sulfide production could also be used to precipitate and stabilize heavy metals in situ. Previous research on bioprecipitation has predominantly focused on using sulfate-reducing bacteria to produce sulfide and precipitate heavy metals as metal sulfides (7,15,16,18,19). However, sulfate-reducing bacteria are obligate anaerobes (2) and their application is limited to anaerobic environments.Sulfide is also produced from sulfate during assimilatory sulfate reduction for the synthesis of cysteine (11) and methionine. Unlike dissimilatory sulfate reduction, assimilatory sulfate reduction is tightly regulated so that little or no excess sulfide is produced and secreted from the cell. Furthermore, assimilatory sulfate reduction operates under many growth conditions, such that the strict anaerobic conditions necessary for dissimilatory sulfate reduction are not required. An aerobic sulfide production pathway could be useful for precipitation and removal or stabilization of heavy metal contaminants, for the formation of metal sulfide quantum particles, or for any other use of sulfide under conditions that are not strictly anaerobic. As a step towards developing such applications, we have redirected the assimilatory sulfate reduction pathway to create an aerobic sulfide production pathway and have shown its use for the biopreci...

show abstract

“…High copy number plasmids are generally preferred for recombinant protein expression to take advantage of the gene dosage effect [19] although sometimes the use of low and moderate copy plasmids can be beneficial. This is due to a tighter control of gene expression, extreme segregational stability, the ability to replicate large pieces of DNA and low metabolic burden on the host strain [2].…”

Section: Introductionmentioning

confidence: 99%

Time-course determination of plasmid content in eukaryotic and prokaryotic cells using Real-Time PCR

et al. 2007

View full text Add to dashboard Cite

A Real-Time PCR method was developed to monitor the plasmid copy number (PCN) in Escherichia coli and Chinese hamster ovary (CHO) cells. E. coli was transformed with plasmids containing a ColE1 or p15A origin of replication and CHO cells were transfected with a ColE1 derived plasmid used in DNA vaccination and carrying the green fluorescent protein (GFP) reporter gene. The procedure requires neither specific cell lysis nor DNA purification and can be performed in <30 min with dynamic ranges covering 0.9 pg-55 ng, and 5.0 pg-2.5 ng of plasmid DNA (pDNA) for E. coli and CHO cells, respectively. Analysis of PCN in E. coli batch cultures revealed that the maximum copy number per cell is attained in mid-exponential phase and that this number decreases on average 80% towards the end of cultivation for both types of plasmids. The plasmid content of CHO cells determined 24 h post-transfection was around 3 x 104 copies per cell although only 37% of the cells expressed GFP one day after transfection. The half-life of pDNA was 20 h and around 100 copies/cell were still detected 6 days after transfection.

show abstract

mRNA stability and plasmid copy number effects on gene expression from an inducible promoter system

Cited by 56 publications

References 18 publications

A highly sensitive selection method for directed evolution of homing endonucleases

A highly sensitive selection method for directed evolution of homing endonucleases

Metabolic Engineering of an Aerobic Sulfate Reduction Pathway and Its Application to Precipitation of Cadmium on the Cell Surface

Time-course determination of plasmid content in eukaryotic and prokaryotic cells using Real-Time PCR

Contact Info

Product

Resources

About