Mouse embryonic stem cells express histidine decarboxylase and histamine H1 receptors

Wiener, Zoltán; Tóth, Sára; Gócza, Elen; Kobolák, Julianna; Falus, András

doi:10.1007/s000110300052

Cited by 5 publications

(4 citation statements)

References 8 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Relative gene expression was calculated according to the 2 −ΔΔCt method ( Livak and Schmittgen, 2001 ) with the GAPDH signal for normalization. Following primer sequences were used: HDC, forward GGATGATGGTACACTTTGACTG, reverse TGTCTGACATGTGCTTGAAGAT ( Wiener et al, 2003 ); GAPDH, forward ATGCATCCTGCACCACCAAC, reverse, ATGCCTGCTTCACCACCTTC ( Gergs et al, 2019c ).…”

Section: Methodsmentioning

confidence: 99%

Histamine can be Formed and Degraded in the Human and Mouse Heart

et al. 2021

View full text Add to dashboard Cite

Histamine is metabolized by several enzymes in vitro and in vivo. The relevance of this metabolism in the mammalian heart in vivo is unclear. However, histamine can exert positive inotropic effects (PIE) and positive chronotropic effects (PCE) in humans via H2-histamine receptors. In transgenic mice (H2-TG) that overexpress the human H2 receptor in cardiomyocytes but not in wild-type littermate mice (WT), histamine induced PIE and PCE in isolated left or right atrial preparations. These H2-TG were used to investigate the putative relevance of histamine degrading enzymes in the mammalian heart. Histidine, the precursor of histamine, increased force of contraction (FOC) in human atrial preparations. Moreover, histamine increased the phosphorylation state of phospholamban in human atrium. Here, we could detect histidine decarboxylase (HDC) and histamine itself in cardiomyocytes of mouse hearts. Moreover, our data indicate that histamine is subject to degradation in the mammalian heart. Inhibition of the histamine metabolizing enzymes diamine oxidase (DAO) and monoamine oxidase (MAO) shifted the concentration response curves for the PIE in H2-TG atria to the left. Moreover, activity of histamine metabolizing enzymes was present in mouse cardiac samples as well as in human atrial samples. Thus, drugs used for other indication (e.g. antidepressants) can alter histamine levels in the heart. Our results deepen our understanding of the physiological role of histamine in the mouse and human heart. Our findings might be clinically relevant because we show enzyme targets for drugs to modify the beating rate and force of the human heart.

show abstract

Section: Methodsmentioning

confidence: 99%

Histamine can be Formed and Degraded in the Human and Mouse Heart

et al. 2021

View full text Add to dashboard Cite

show abstract

“…HA increases its content at embryonic days (E) 14–16, and then decreases perinatally [ 13 ],[ 15 ]–[ 17 ]. Histidine decarboxylase (HDC), which synthetizes HA, and the mRNAs for H 1 R, H 2 R and H 3 R [ 18 ]–[ 21 ] are also expressed at these developmental stages [ 20 ],[ 22 ],[ 23 ]. The transitory expression of HDC in the midbrain, together with elevated HA levels, and the expression of HRs, coincides with periods of dopaminergic specification [ 24 ], suggesting that HA might influence dopamine (DA) neuron generation in the ventral midbrain (VM).…”

Section: Introductionmentioning

confidence: 99%

Histamine impairs midbrain dopaminergic development in vivo by activating histamine type 1 receptors

et al. 2014

View full text Add to dashboard Cite

BackgroundHistamine (HA) regulates the sleep-wake cycle, synaptic plasticity and memory in adult mammals. Dopaminergic specification in the embryonic ventral midbrain (VM) coincides with increased HA brain levels. To study the effect of HA receptor stimulation on dopamine neuron generation, we administered HA to dopamine progenitors, both in vitro and in vivo.ResultsCultured embryonic day 12 (E12) VM neural stem/progenitor cells expressed transcripts for HA receptors H1R, H2R and H3R. These undifferentiated progenitors increased intracellular calcium upon HA addition. In HA-treated cultures, dopamine neurons significantly decreased after activation of H1R. We performed intrauterine injections in the developing VM to investigate HA effects in vivo. HA administration to E12 rat embryos notably reduced VM Tyrosine Hydroxylase (TH) staining 2 days later, without affecting GABA neurons in the midbrain, or serotonin neurons in the mid-hindbrain boundary. qRT-PCR and Western blot analyses confirmed that several markers important for the generation and maintenance of dopaminergic lineage such as TH, Lmx1a and Lmx1b were significantly diminished. To identify the cell type susceptible to HA action, we injected embryos of different developmental stages, and found that neural progenitors (E10 and E12) were responsive, whereas differentiated dopaminergic neurons (E14 and E16) were not susceptible to HA actions. Proliferation was significantly diminished, whereas neuronal death was not increased in the VM after HA administration. We injected H1R or H2R antagonists to identify the receptor responsible for the detrimental effect of HA on dopaminergic lineage and found that activation of H1R was required.ConclusionThese results reveal a novel action of HA affecting dopaminergic lineage during VM development.

show abstract

“…1). Furthermore, histidine decarboxylase, the enzyme that synthesizes HA from L-histidine, is expressed in the brain at E14 and E15 in neuronal populations located in the choroid plexus and mesencephalon, respectively (Nissinen et al 1995;Karlstedt et al 2001a;Wiener et al 2003). From E14 to E18, efferents from the transient mesencephalic HAergic neurons (see below) are detected in the ventral tegmental area and within the medial forebrain and the optic tract from where they send projections to the frontal and parietal cortices Panula et al 1988;Vanhala et al 1994).…”

mentioning

confidence: 99%

Histamine in brain development

Molina‐Hernández

Díaz

Arias‐Montaño

2012

Journal of Neurochemistry

View full text Add to dashboard Cite

J. Neurochem. (2012) 122, 872–882. Abstract The function of histamine in the adult central nervous system has been extensively studied, but data on its actions upon the developing nervous system are still scarce. Herein, we review the available information regarding the possible role for histamine in brain development. Some relevant findings are the existence of a transient histaminergic neuronal system during brain development, which includes serotonergic neurons in the midbrain and the rhombencephalon that coexpress histamine; the high levels of histamine found in several areas of the embryo nervous system at the neurogenic stage; the presence of histaminergic fibers and the expression of histamine receptors in various areas of the developing brain; and the neurogenic and proliferative effects on neural stem cells following histamine H1‐ and H2‐receptor activation, respectively. Altogether, the reviewed information supports a significant role for histamine in brain development and the need for further research in this field.

show abstract

Mouse embryonic stem cells express histidine decarboxylase and histamine H1 receptors

Cited by 5 publications

References 8 publications

Histamine can be Formed and Degraded in the Human and Mouse Heart

Histamine can be Formed and Degraded in the Human and Mouse Heart

Histamine impairs midbrain dopaminergic development in vivo by activating histamine type 1 receptors

Histamine in brain development

Contact Info

Product

Resources

About