Motility Is Crucial for the Infectious Life Cycle of Borrelia burgdorferi

Abstract

The Lyme disease spirochete, Borrelia burgdorferi, exists in a zoonotic cycle involving an arthropod tick and mammalian host. Dissemination of the organism within and between these hosts depends upon the spirochete's ability to traverse through complex tissues. Additionally, the spirochete outruns the host immune cells while migrating through the dermis, suggesting the importance of B. burgdorferi motility in evading host clearance. B. burgdorferi's periplasmic flagellar filaments are composed primarily of a major protein, FlaB, and minor protein, FlaA. By constructing a flaB mutant that is nonmotile, we investigated for the first time the absolute requirement for motility in the mouse-tick life cycle of B. burgdorferi. We found that whereas wildtype cells are motile and have a flat-wave morphology, mutant cells were nonmotile and rod shaped. These mutants were unable to establish infection in C3H/HeN mice via either needle injection or tick bite. In addition, these mutants had decreased viability in fed ticks. Our studies provide substantial evidence that the periplasmic flagella, and consequently motility, are critical not only for optimal survival in ticks but also for infection of the mammalian host by the arthropod tick vector.

Borrelia burgdorferi CheD Promotes Various Functions in Chemotaxis and the Pathogenic Life Cycle of the Spirochete

“…Construction of the cheD inactivation plasmids, electroporation, and plating conditions were described previously (8,44). Briefly, the cheD gene (locus number bb0606) and flanking DNA were first amplified by PCR from the chromosomal DNA of B. burgdorferi strain B31-A3 using primers CheD-KO-F (GGAATCAGGCTTAAATCTTG) and CheD-KO-R (AAGCATGG AAAGTTGAAACC).…”

“…The cheD gene was inactivated using a kanamycin resistance cassette (P flgB -aph1) (36), which was inserted at the HindIII sites located within cheD. Competent B31-A3 cells were electroporated with cheD-P flgB -aph1 DNA that was linearized by NotI restriction digestion to remove the ampicillin restriction marker of the vector, preventing it from being introduced into B. burgdorferi (8,44). The transformants were selected with kanamycin, and the kanamycin-resistant transformants were confirmed by PCR to have P flgB -aph1 integrated within cheD (8,44,45).…”

“…The construction of cheD mutants and complemented strains is described below. B. burgdorferi cells were cultured in liquid Barbour-Stoenner-Kelly (BSK-II) medium, and plating BSK was prepared using 0.5% agarose (8,41,42). Cells were grown at 35°C in a 2.5% CO 2 humidified incubator as described previously (8,37,41).…”

“…Competent B31-A3 cells were electroporated with cheD-P flgB -aph1 DNA that was linearized by NotI restriction digestion to remove the ampicillin restriction marker of the vector, preventing it from being introduced into B. burgdorferi (8,44). The transformants were selected with kanamycin, and the kanamycin-resistant transformants were confirmed by PCR to have P flgB -aph1 integrated within cheD (8,44,45). Confirmation of cheD gene inactivation was achieved by the lack of cheD transcripts in the cheD mutant (⌬cheD) cells by quantitative reverse transcriptase (qRT)-PCR (see below).…”

“…Motility and chemotaxis are known to be required for host tissue colonization or disease production by many bacteria, including the spirochetes; however, these processes have not been rigorously characterized in any spirochete (1)(2)(3)(4)(5)(6)(7)(8)(9)(10)(11)(12)(13). B. burgdorferi is a spirochetal motile bacterium that contains a sophisticated and complicated chemotaxis signal transduction system.…”