Morin Protects Channel Catfish From Aeromonas hydrophila Infection by Blocking Aerolysin Activity

Abstract

Aeromonas hydrophila (A. hydrophila) is an opportunistic bacterial pathogen widely distributed in the environments, particular aquatic environment. The pathogen can cause a range of infections in both human and animals including fishes. However, the application of antibiotics in treatment of A. hydrophila infections leads to the emergence of resistant strains. Consequently, new approaches need to be developed in fighting this pathogen. Aerolysin, the chief virulence factor produced by pathogenic A. hydrophila strains has been employed as target identifying new drugs. In our present study, we found that morin, a flavonoid without anti-bacterial activity isolated from traditional Chinese medicine, could directly inhibit the hemolytic activity of aerolysin. To determine the binding sites and the action of mechanism of morin against AerA, several assays were performed. Ser36, Pro347, and Arg356 were identified as the main binding sites affecting the conformation of AerA and resulted in block of the heptameric formation. Moreover, morin could protect Vero cells from cell injury mediated by aerolysin. In vivo study showed that morin could provide a protection to channel catfish against A. hydrophila infection. These results demonstrated that morin could be developed as a promising candidate for the treatment of A. hydrophila infections by decreasing the pathogenesis of A. hydrophila.

Luteolin decreases the pathogenicity of Aeromonas hydrophila via inhibiting the activity of aerolysin

“…Moreover, the increasing knowledge of structure and pore assembly of AerA makes it possible to clarify the mechanism of luteolin against the activity of AerA [48,49]. Our previous study confirmed that Arg356, Pro347 and Asn 37 were major binding sites of morin-AerA complex [18]. Here, we found that Asp7 and Asp311 were major sites when determined by the same methods with morin.…”

“…According to previous study, AerA could lead to cell injury of a number of mammalian cells [ 28 ]. Our previous studies indicated that A549 and Vero cells could be used as target cells to evaluate the effects of natural compounds to AerA induced cell injury [ 18 , 19 ]. As shown in Figure 7(a ), untreated cells were shown green, indicating that cells were live.…”

“…Impact of luteolin on hemolytic activities was determined by purified aerolysin (AerA) and bacterial supernatants co-cultured with indicated concentrations of luteolin according to previous studies [ 18 , 19 ]. For hemolytic activity of bacterial supernatants, the supernatants were centrifuged when the OD 600nm reached 1.5 of A. hydrophila co-cultured with luteolin.…”

“…The plasmids encoding D7A-pAerA and D311A-pAerA were conducted according to our previous study [ 18 ]. Primer pairs used for D7A-pAerA were 5ʹ- GAGCCCGTCTATCCAGCGCAGCTGCGCCTGTTCTC-3ʹ (forward) and 5ʹ- GAGAACAGGCGCAGCTGCGCTGGATAGACGGGCTC (reverse).…”

Rosmarinus officinalis L. (Rosemary) Extracts Containing Carnosic Acid and Carnosol are Potent Quorum Sensing Inhibitors of Staphylococcus aureus Virulence

“…The use of flavonoids and other small molecules from plants as anti-virulence agents has been reported previously and reader is directed to the excellent review by Wu et al [42]. Dong et al showed that the flavonoid morin, used in traditional Chinese medicine, directly inhibits the hemolytic activity of aerolysin, the primary virulence factor of A. hydrophila strains and protects catfish from A. hydrophila infection [43]. Eugenol, a constituent of clove oil, can inhibit quorum sensing in methicillin-resistant S. aureus (MRSA) clinical strains [44].…”