Mono‐, di‐ and trimeric binding of a bis‐netropsin to DNA

Заседателев, А. С.; Бородулин, В. Б.; Grokhovsky, S. L.; Nikitin, Alexei; Salmanova, D. V.; Жузе, А. Л.; Gursky, G. V.; Shafer, Richard H.

doi:10.1016/0014-5793(95)01230-c

Cited by 10 publications

(7 citation statements)

References 7 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The first type of complex corresponds to the monomer form of bis-netropsin binding to DNA polymer, whereas the second type involves the case where the ligand binds the DNA in the trimer form. The bis-netropsin's monomer and trimer, both shown to have the same length of the DNA binding site (14,15).…”

Section: Bis-netropsin Binding To Poly(da-dt) Poly(da-dt)mentioning

confidence: 98%

“…Figure 3 compares experimental data on bis-netropsin binding to poly(dA-dT) poly(dA-dT) with the theoretical curves calculated according [6][7][8][9] for the values of K1 = 1.0x10 8 M -1 , K2 = 1.0x10 20 M -1 , and L= 10. The results of calculations were compared with the experimental data in the assumption that the contribution of trimer into the overall spectrum is the sum of the spectra of monomer and dimer forming the complex with monomer (14,15). In any case, the S-shape of the binding curve for the second type of the complex at DNA can be explained by the fact that there are three times less DNA pairs per one ligand in bis-netropsin trimer.…”

Section: Bis-netropsin Binding To Poly(da-dt) Poly(da-dt)mentioning

confidence: 99%

“…Bis-netropsin is known to form two types of complexes with DNA polymers. The spectral characteristics of the complexes are well characterized, and individual binding curves for each of these complexes are described (14,15). The first type of complex corresponds to the monomer form of bis-netropsin binding to DNA polymer, whereas the second type involves the case where the ligand binds the DNA in the trimer form.…”

Section: Bis-netropsin Binding To Poly(da-dt) Poly(da-dt)mentioning

confidence: 99%

“…Some of the anticancer agents are known to exhibit higher anticancer activity in the presence of cooperative interactions between them whereas other are more active in the "monomeric" form (11,12). In many studies of ligand binding with nucleic acids, both experimental and theoretical, S-shaped curves were obtained (13)(14)(15)(16)(17)(18)(19). However, in all these cases (16)(17)(18)(19), such curves appeared either when positive cooperative interactions were introduced into the model, or in the case of competitive binding of different ligands to DNA.…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Mixed Mode of Ligand-DNA Binding Results in S-Shaped Binding Curves

Nechipurenko

Mikheikin

Streltsov

et al. 2001

Journal of Biomolecular Structure and Dynamics

View full text Add to dashboard Cite

S-shaped binding curves often characterize interactions of ligands with nucleic acid molecules as analyzed by different physico-chemical and biophysical techniques. S-shaped experimental binding curves are usually interpreted as indicative of the positive cooperative interactions between the bound ligand molecules. This paper demonstrates that S-shaped binding curves may occur as a result of the "mixed mode" of DNA binding by the same ligand molecule. Mixed mode of the ligand-DNA binding can occur, for example, due to 1) isomerization or dimerization of the ligands in solution or on the DNA lattice, 2) their ability to intercalate the DNA and to bind it within the minor groove in different orientations. DNA-ligand complexes are characterized by the length of the ligand binding site on the DNA lattice (so-called "multiple-contact" model). We show here that if two or more complexes with different lengths of the ligand binding sites could be produced by the same ligand, the dependence of the concentration of the complex with the shorter length of binding site on the total concentration of ligand should be S-shaped. Our theoretical model is confirmed by comparison of the calculated and experimental CD binding curves for bis-netropsin binding to poly(dA-dT) poly(dA-dT). Bis-netropsin forms two types of DNA complexes due to its ability to interact with the DNA as monomers and trimers. Experimental S-shaped bis-netropsin-DNA binding curve is shown to be in good correlation with those calculated on the basis of our theoretical model. The present work provides new insight into the analysis of ligand-DNA binding curves.

show abstract

Section: Bis-netropsin Binding To Poly(da-dt) Poly(da-dt)mentioning

confidence: 98%

Section: Bis-netropsin Binding To Poly(da-dt) Poly(da-dt)mentioning

confidence: 99%

Section: Bis-netropsin Binding To Poly(da-dt) Poly(da-dt)mentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Mixed Mode of Ligand-DNA Binding Results in S-Shaped Binding Curves

Nechipurenko

Mikheikin

Streltsov

et al. 2001

Journal of Biomolecular Structure and Dynamics

View full text Add to dashboard Cite

show abstract

“…At high concentrations they bind practically to any sequence which contains more than three successive AT base pairs. Besides, at high concentrations bis-Nts may form dimer sandwich complexes within a minor groove and these dimers widen it locally [25].…”

Section: Discussionmentioning

confidence: 99%

Human DNA‐topoisomerase I activity is affected by bis‐netropsin's binding to DNA minor groove

et al. 1998

View full text Add to dashboard Cite

SUMMARYBis-netropsins (bis-Nts) are known to be efficient inhibitors of human DNA topoisomerase (topo) I with a higher antitumor activity than netropsin. New sequence-specific derivatives of bis-Nts were used for modulation of topo I-mediated DNA cleavage with and without camptothecin (CPT). Relation between the bis-Nts binding sites and topo I cleavage sites has been analyzed with the plasmid DNA constructs generated by insertion of synthetic oligonucleotides containing various topo I-cleavage and bis-Nt-binding sites. These constructs offer an opportunity to study minor groove binders effects on the topo I reaction on DNA. Three major effects: (i) bis-Nt -mediated disappearance of some of the topo I cleavage sites; (ii) enhancement of some other sites, and, (iii) generation of new cleavage sites, have been found and analyzed. These effects demonstrate that bis-Nts drastically change the topo Imediated DNA cleavage.

show abstract

Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study

Kittler¹,

Baguley

Löber³

et al. 1999

J. Mol. Recognit.

View full text Add to dashboard Cite

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

show abstract

Mono‐, di‐ and trimeric binding of a bis‐netropsin to DNA

Cited by 10 publications

References 7 publications

Mixed Mode of Ligand-DNA Binding Results in S-Shaped Binding Curves

Mixed Mode of Ligand-DNA Binding Results in S-Shaped Binding Curves

Human DNA‐topoisomerase I activity is affected by bis‐netropsin's binding to DNA minor groove

Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study

Contact Info

Product

Resources

About