Molecular phylogeny of the spider family Sparassidae with focus on the genus Eusparassus and notes on the RTA-clade and ‘Laterigradae’

Moradmand, Majid; Schönhofer, Axel L.; Jäger, Peter

doi:10.1016/j.ympev.2014.01.021

Cited by 34 publications

(27 citation statements)

References 58 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We amplified two mitochondrial genes, the cytochrome oxidase I (587 pb; COI; Folmer, Black, Hoeh, Lutz, & Vrijenhoek, ) and the 16S ribosomal DNA gene (397 pb; 16s; Simon et al., ), using the conditions reported in previous studies (Blackledge et al., ; McHugh, Yablonsky, Binford, & Agnarsson, ; Peres et al., ). We also sequenced two nuclear loci, the internal transcribed spacer 2 (296 pb; ITS; White, Bruns, Lee, & Taylor, ) and 28S ribosomal DNA gene (681 pb; 28s; Hedin & Maddison, ), using primers previously developed for spiders (Moradmand, Schönhofer, & Jäger, ; Peres et al., ). At last, we used the published transcriptome of G. cancriformis (Prosdocimi et al., ) and designed the forward primer (5′‐ CAATTACACCTGGGAATCTTCTG‐3′) and reverse primer (5′‐CCCTGACAAAATTCAAATAGTCG‐3′) to amplify a 560‐bp fragment of the heat shock protein 90 (HSP90), a gene that was used previously in phylogenetic studies in Heliconius (Salazar et al., ).…”

Section: Methodsmentioning

confidence: 99%

Gene flow and Andean uplift shape the diversification of Gasteracantha cancriformis (Araneae: Araneidae) in Northern South America

Salgado-Roa

Pardo‐Díaz

Lasso

et al. 2018

Ecology and Evolution

View full text Add to dashboard Cite

The Andean uplift has played a major role in shaping the current Neotropical biodiversity. However, in arthropods other than butterflies, little is known about how this geographic barrier has impacted species historical diversification. Here, we examined the phylogeography of the widespread color polymorphic spider Gasteracantha cancriformis to evaluate the effect of the northern Andean uplift on its divergence and assess whether its diversification occurred in the presence of gene flow. We inferred phylogenetic relationships and divergence times in G. cancriformis using mitochondrial and nuclear data from 105 individuals in northern South America. Genetic diversity, divergence, and population structure were quantified. We also compared multiple demographic scenarios for this species using a model‐based approach (phrapl) to determine divergence with or without gene flow. At last, we evaluated the association between genetic variation and color polymorphism. Both nuclear and mitochondrial data supported two well‐differentiated clades, which correspond to populations occurring on opposite sides of the Eastern cordillera of the Colombian Andes. The final uplift of this cordillera was identified as the most likely force that shaped the diversification of G. cancriformis in northern South America, resulting in a cis‐ and trans‐Andean phylogeographic structure for the species. We also found shared genetic variation between the cis‐ and trans‐Andean clades, which is better explained by a scenario of historical divergence in the face of gene flow. This has been likely facilitated by the presence of low‐elevation passes across the Eastern Colombian cordillera. Our work constitutes the first example in which the Andean uplift coupled with gene flow influenced the evolutionary history of an arachnid lineage.

show abstract

Section: Methodsmentioning

confidence: 99%

Gene flow and Andean uplift shape the diversification of Gasteracantha cancriformis (Araneae: Araneidae) in Northern South America

Salgado-Roa

Pardo‐Díaz

Lasso

et al. 2018

Ecology and Evolution

View full text Add to dashboard Cite

show abstract

“…A growing number of multi‐family target gene phylogenetic analyses are incrementally covering parts of the spider tree of life. These studies have focused on Mesothelae (Xu et al., ), Mygalomorphae (Bond et al., ; and references therein), Palpimanoidea (Wood et al., ), many on orb‐weavers (Blackledge et al., ; Dimitrov et al., ; and references therein), symphytognathoids (Rix et al., ; Lopardo et al., ; Lopardo and Hormiga, ), entelegynes (J. Miller et al., ; Spagna et al., ), the Oval Calamistrum (OC) clade (Polotow et al., ), psechrids (Agnarsson et al., ; Bayer and Schönhofer, ), eresids (Miller et al., ), pholcids (Dimitrov et al., ) and sparassids (Moradmand et al., ). These analyses show significant agreement as well as important contradictions.…”

Section: Introductionmentioning

confidence: 99%

The spider tree of life: phylogeny of Araneae based on target‐gene analyses from an extensive taxon sampling

et al. 2016

View full text Add to dashboard Cite

We present a phylogenetic analysis of spiders using a dataset of 932 spider species, representing 115 families (only the family Synaphridae is unrepresented), 700 known genera, and additional representatives of 26 unidentified or undescribed genera. Eleven genera of the orders Amblypygi, Palpigradi, Schizomida and Uropygi are included as outgroups. The dataset includes six markers from the mitochondrial (12S, 16S, COI) and nuclear (histone H3, 18S, 28S) genomes, and was analysed by multiple methods, including constrained analyses using a highly supported backbone tree from transcriptomic data. We recover most of the higher‐level structure of the spider tree with good support, including Mesothelae, Opisthothelae, Mygalomorphae and Araneomorphae. Several of our analyses recover Hypochilidae and Filistatidae as sister groups, as suggested by previous transcriptomic analyses. The Synspermiata are robustly supported, and the families Trogloraptoridae and Caponiidae are found as sister to the Dysderoidea. Our results support the Lost Tracheae clade, including Pholcidae, Tetrablemmidae, Diguetidae, Plectreuridae and the family Pacullidae (restored status) separate from Tetrablemmidae. The Scytodoidea include Ochyroceratidae along with Sicariidae, Scytodidae, Drymusidae and Periegopidae; our results are inconclusive about the separation of these last two families. We did not recover monophyletic Austrochiloidea and Leptonetidae, but our data suggest that both groups are more closely related to the Cylindrical Gland Spigot clade rather than to Synspermiata. Palpimanoidea is not recovered by our analyses, but also not strongly contradicted. We find support for Entelegynae and Oecobioidea (Oecobiidae plus Hersiliidae), and ambiguous placement of cribellate orb‐weavers, compatible with their non‐monophyly. Nicodamoidea (Nicodamidae plus Megadictynidae) and Araneoidea composition and relationships are consistent with recent analyses. We did not obtain resolution for the titanoecoids (Titanoecidae and Phyxelididae), but the Retrolateral Tibial Apophysis clade is well supported. Penestomidae, and probably Homalonychidae, are part of Zodarioidea, although the latter family was set apart by recent transcriptomic analyses. Our data support a large group that we call the marronoid clade (including the families Amaurobiidae, Desidae, Dictynidae, Hahniidae, Stiphidiidae, Agelenidae and Toxopidae). The circumscription of most marronoid families is redefined here. Amaurobiidae include the Amaurobiinae and provisionally Macrobuninae. We transfer Malenellinae (Malenella, from Anyphaenidae), Chummidae (Chumma) (new syn.) and Tasmarubriinae (Tasmarubrius, Tasmabrochus and Teeatta, from Amphinectidae) to Macrobuninae. Cybaeidae are redefined to include Calymmaria, Cryphoeca, Ethobuella and Willisius (transferred from Hahniidae), and Blabomma and Yorima (transferred from Dictynidae). Cycloctenidae are redefined to include Orepukia (transferred from Agelenidae) and Pakeha and Paravoca (transferred from Amaurobiidae). Desidae are rede...

show abstract

“…The geological history of the Indian West coast indicates that the Western Ghats have been formed 150 mya during the break-up of Gondwana and came into being around 100 to 80 mya. This period was suggested as the time when the basal split within the Sparassidae occurred (Moradmand et al 2014) rather than a time of diversifying within single genera like Pseudopoda (< 50 mya: Moradmand et al 2014). During the same period (circa), the Indian raft was introduced to Asia allowing a passage for exchange of species (Conti et al 2002).…”

Section: Discussionmentioning

confidence: 99%

An unexpected new species of the genus Pseudopoda (Araneae, Sparassidae, Heteropodinae) from the Western Ghats in India

Jäger¹,

Kulkarni²

2016

View full text Add to dashboard Cite

show abstract

Molecular phylogeny of the spider family Sparassidae with focus on the genus Eusparassus and notes on the RTA-clade and ‘Laterigradae’

Cited by 34 publications

References 58 publications

Gene flow and Andean uplift shape the diversification of Gasteracantha cancriformis (Araneae: Araneidae) in Northern South America

Gene flow and Andean uplift shape the diversification of Gasteracantha cancriformis (Araneae: Araneidae) in Northern South America

The spider tree of life: phylogeny of Araneae based on target‐gene analyses from an extensive taxon sampling

An unexpected new species of the genus Pseudopoda (Araneae, Sparassidae, Heteropodinae) from the Western Ghats in India

Contact Info

Product

Resources

About