Molecular Mimics of Insulin-like Growth Factor 1 (IGF-1) for Inhibiting IGF-1:  IGF-Binding Protein Interactions

Lowman, Henry B.; Chen, Yvonne M.; Skelton, Nicholas J.; Mortensen, Deborah L.; Tomlinson, Elizabeth E.; Sadick, Michael D.; Robinson, I. C. A. F.; Clark, R. G.

doi:10.1021/bi980426e

Cited by 96 publications

(109 citation statements)

References 44 publications

Supporting

Mentioning

105

Contrasting

Order By: Relevance

“…However, that compound is not specific for a single form of IGFBP. Because HepG2 cells synthesize and secrete IG-FBP-1, -2 and -4, in the current study we utilized bp1-01, a molecular mimic that binds specifically to IGFBP-1 and not to other forms of IGFBPs, such as IGFBP-3 (18).…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Increases in Free, Unbound Insulin-like Growth Factor I Enhance Insulin Responsiveness in Human Hepatoma G2 Cells in Culture

Sakai¹,

Lowman²,

Clemmons³

2002

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

Section: Discussionmentioning

confidence: 99%

“…In previous studies, investigators used phage-display libraries to identify a disulfide-containing peptide (bp1-01, CRAG-PLQWLCEKYF) that bound to the IGF-I binding site on human IGFBP-1 (18). This peptide had a high affinity for human IGFBP-1, and it blocked human IGF-I binding to IGFBP-1 with an IC 50 of 180 nM.…”

Section: Insulin-like Growth Factor (Igf)mentioning

confidence: 99%

Increases in Free, Unbound Insulin-like Growth Factor I Enhance Insulin Responsiveness in Human Hepatoma G2 Cells in Culture

Sakai¹,

Lowman²,

Clemmons³

2002

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

“…In this erythropoietin-mimic peptide, the GP motif introduces a ␤-turn structure linking two short ␤-strands, and it also mediates important contacts with the erythropoietin receptor. Several phage libraries displaying cyclic peptides that contain a central GP motif have been successfully used to identify structurally constrained peptides that bind with high affinity to cell surface receptors (29,36,37). Interestingly, the EphB4-binding peptides containing the GP motif were isolated from an unbiased and linear peptide library.…”

Section: Fig 5 Peptides As Ephb Receptor-targeting Agentsmentioning

confidence: 99%

EphB Receptor-binding Peptides Identified by Phage Display Enable Design of an Antagonist with Ephrin-like Affinity

Koolpe

Burgess

Dail

et al. 2005

Journal of Biological Chemistry

130

156

View full text Add to dashboard Cite

The Eph receptor tyrosine kinases are overexpressed in many pathologic tissues and have therefore emerged as promising drug target candidates. However, there are few molecules available that can selectively bind to a single Eph receptor and not other members of this large receptor family. Here we report the identification by phage display of peptides that bind selectively to different receptors of the EphB class, including EphB1, EphB2, and EphB4. Peptides with the same EphB receptor specificity compete with each other for binding, suggesting that they have partially overlapping binding sites. In addition, several of the peptides contain amino acid motifs found in the G-H loop of the ephrin-B ligands, which is the region that mediates high-affinity interaction with the EphB receptors. Consistent with targeting the ephrin-binding site, the higher affinity peptides antagonize ephrin binding to the EphB receptors. We also designed an optimized EphB4-binding peptide with affinity comparable with that of the natural ligand, ephrin-B2. These peptides should be useful as selective inhibitors of the pathological activities of EphB receptors and as targeting agents for imaging probes and therapeutic drugs.

show abstract

“…The DNA fragment was digested with EcoRI and NsiI and ligated with the large fragment resulting from a similar digestion of a P8 display phagemid (19). The method of Kunkel et al (20) was used to insert eight codons (TAATAACATCACCATCACCATGCG) immediately following the final codon of the P8 open reading frame.…”

Section: Materials-reagentsmentioning

confidence: 99%

Analysis of PDZ Domain-Ligand Interactions Using Carboxyl-terminal Phage Display

Fuh¹,

Pisabarro²,

Ying³

et al. 2000

Journal of Biological Chemistry

158

110

View full text Add to dashboard Cite

PDZ domains, originally described as conserved structural elements in the 95-kDa post-synaptic density protein (PSD-95), 1 the Drosophila tumor suppressor discs-large, and the tight junction protein zonula occludens-1 (ZO-1), are contained in a large and diverse set of proteins (1-3). In general, PDZ domain-containing proteins appear to assemble various functional entities, including ion channels and other transmembrane receptors, at specialized subcellular sites such as epithelial cell tight junctions, neuromuscular junctions, and postsynaptic densities of neurons. These clustering and localization effects have important biological implications. For example, the membrane-associated guanylate kinase, PSD-95, segregates the N-methyl D-aspartate (NMDA) receptor and the Shaker potassium channel to the post-synaptic density of neurons (4). In another illustration, the aggregation of various components of the fruit fly visual system by the multi-PDZ protein INAD greatly enhances the efficiency of this signaling cascade (5). Another compelling case is the use of several PDZ domaincontaining proteins in the appropriate basolateral localization of the LET-23 receptor tyrosine kinase of Caenorhabditis elegans (6). This kinase is required for vulval development, and mutations in these PDZ domain-containing proteins result in the subcellular mislocalization of the LET-23 protein and a lack of vulval differentiation. Together with many other examples, these studies indicate that PDZ domains are important intracellular assembly and localization cofactors in diverse signaling pathways.PDZ domains recognize three different types of ligands, with two of these interactions showing specificity for peptides at the extreme carboxyl termini of proteins (7-9). Type I and type II PDZ domains recognize carboxyl-terminal peptides with the consensus sequence Thr/Ser-X-Phe/Val/Ala-COOH or Phe/Tyr-X-Phe/Val/Ala-COOH, respectively. Interestingly, a third type of PDZ domain-ligand interaction involves the recognition of an internal peptide sequence. Structural analyses of these three types of PDZ interactions have illuminated the mechanisms of ligand recognition. For example, the crystal structure of a type I PDZ domain from PSD-95 showed that a 4-residue carboxylterminal peptide interacts with the protein via an antiparallel main chain association with a ␤ strand, and the terminal carboxylate is inserted into a conserved "carboxylate binding loop" (10, 11). The crystal structure of a PDZ domain from human CASK revealed the nature of interactions mediated by type II motifs (12). In both domain types, the peptide formed a new antiparallel ␤ strand in the PDZ domain structure, and the overall conformations of the two interactions were similar. However, there were significant differences in side chain contacts that could account for the different ligand specificities of the two domain types. Finally, the interaction between a PDZ domain of syntrophin and a PDZ domain of the neuronal nitric oxide synthase has been examined by x-ray and NMR analy...

show abstract

Molecular Mimics of Insulin-like Growth Factor 1 (IGF-1) for Inhibiting IGF-1: IGF-Binding Protein Interactions

Cited by 96 publications

References 44 publications

Increases in Free, Unbound Insulin-like Growth Factor I Enhance Insulin Responsiveness in Human Hepatoma G2 Cells in Culture

Increases in Free, Unbound Insulin-like Growth Factor I Enhance Insulin Responsiveness in Human Hepatoma G2 Cells in Culture

EphB Receptor-binding Peptides Identified by Phage Display Enable Design of an Antagonist with Ephrin-like Affinity

Analysis of PDZ Domain-Ligand Interactions Using Carboxyl-terminal Phage Display

Contact Info

Product

Resources

About