Molecular Markers Improve Breeding Efficiency in Apomictic Poa Pratensis L.

Abstract

Kentucky bluegrass (Poa pratensis L.) is a highly adapted and important turfgrass species in cool-season climates. It has high and variable polyploidy, small and metacentric chromosomes, and a facultative apomictic breeding system. As a result of the polyploidy and apomixis, identifying hybrids for Mendelian selection, identifying fixed apomictic progeny of desirable hybridizations for cultivar development, or differentiating among cultivars with subtle phenotypic differences is challenging without the assistance of molecular markers. Herein, we show data and review previous research showing the uses and limitations of using molecular markers for hybrid detection, apomixis assessment, and cultivar discrimination. In order to differentiate among different apomictic offtypes, both molecular markers and flow cytometry are necessary. For assessing similarity among progeny of hybridizations, as well as discriminating among cultivars, sets of markers are necessary and cryptic molecular variation must be considered. High throughput genotyping platforms are critical for increased genotyping efficiency.

Inheritance of salt‐tolerance traits among Kentucky bluegrass hybrids

“…Higher TQ ratings for such entries were, at times, attributed to less visible dead leaf tissue concealed by a denser canopy. As EL tends to describe symptoms of salt stress before visible TQ stress (Bushman et al., 2018), it would be interesting for further studies to carry out salt stress for longer periods in order to determine if entries with low EL still have higher TQ over longer timeframes.…”

“…Flow cytometry used propidium iodide stain following the protocol in Bushman et al. (2018) with chicken erythrocyte nuclei spiked into the samples to determine picograms DNA. Hybrids are classified as per Huff and Bara (1993).…”

“…The 15 hybrids in this experiment were identified using those primers and were further classified with flow cytometry. Flow cytometry used propidium iodide stain following the protocol in Bushman et al (2018) with chicken erythrocyte nuclei spiked into the samples to determine picograms DNA. Hybrids are classified as per Huff and Bara (1993).…”

“…These parents and their hybrids are listed in Table 1. Five crosses were made among these parents and 100 progeny were genotyped previously from each cross as per (Bushman et al, 2018) using simple sequence repeat primers 2GHPD8 (F: 5′TCTGGCATCGCGAAAA, R: 5′TCCAGGGGATTTTTGAAGC), 2JGUKJ (F: 5′TCAT-CATCGTCGTCGTCGT, R: 5′TACCCTTCGGCTCG-TATCC), na7079 (F:5′GACCTTCCTCACCGTCACC, R: 5′CGTCGAGATCGACAGGCT), and i17908 (F: 5′GGGACACCTTTTCCTTAGTTTGTA, R: 5′CACAA-GAGAGAAGAACAGTTCGAG). The 15 hybrids in this experiment were identified using those primers and were further classified with flow cytometry.…”

“…In the absence of obvious phenotypic differences between parents, hybrids and other offtypes must be characterized through molecular markers and flow cytometry (Bushman, Joshi, & Johnson, 2018). Once hybrids are identified, KBG also has the additional challenge of high polyploidy, ranging from approximately 2 n = 8 x to greater than 2 n = 14 x (Bushman et al., 2018; Huff & Bara, 1993). With the high and variable ploidy comes a dosage effect for genes, where heterozygous loci can have one or many doses of an allele (Haldane, 1930).…”