Molecular identification of two newly identified human pathogens causing leishmaniasis using PCR-based methods on the 3′ untranslated region of the heat shock protein 70 (type I) gene

Abstract

PCR-based methods to amplify the 3′ untranslated region (3′-UTR) of the heat shock protein 70 (type I) gene (HSP70-I) have previously been used for typing of Leishmania but not with Leishmania (Mundinia) martiniquensis and L. (Mundinia) orientalis, newly identified human pathogens. Here, the 3′-UTRs of HSP70-I of L. martiniquensis, L. orientalis, and 10 other species were sequenced and analyzed. PCR-Restriction Fragment Length Polymorphism (RFLP) analysis targeting the 3′-UTR of HSP70-I was developed. Also, the detection limit of HSP70-I-3′-UTR PCR methods was compared with two other commonly used targets: the 18S small subunit ribosomal RNA (SSU-rRNA) gene and the internal transcribed spacer 1 region of the rRNA (ITS1-rRNA) gene. Results showed that HSP70-I-3′-UTR PCR methods could be used to identify and differentiate between L. martiniquensis (480–2 bp) and L. orientalis (674 bp) and distinguished them from parasites of the subgenus Viannia and of the subgenus Leishmania. PCR-RFLP patterns of the 3′-UTR of HSP70-I fragments digested with BsuRI restriction enzyme successfully differentiated L. martiniquensis, L. orientalis, L. braziliensis, L. guyanensis = L. panamensis, L. mexicana = L. aethiopica = L. tropica, L. amazonensis, L. major, and L. donovani = L. infantum. For the detection limit, the HSP70-I-3′-UTR PCR method could detect the DNA of L. martiniquensis and L. orientalis at the same concentration, 1 pg/μL, at a similar level to the SSU-rRNA PCR. The PCR that amplified ITS1-rRNA was more sensitive (0.01 pg/μL) than that of the HSP70-I-3′-UTR PCR. However, the sizes of both SSU-rRNA and ITS1-rRNA PCR amplicons could not differentiate between L. martiniquensis and L. orientalis. This is the first report of using HSP70-I-3′-UTR PCR based methods to identify the parasites causing leishmaniasis in Thailand. Also, the BsuRI-PCR-RFLP method can be used for differentiating some species within other subgenera.

Leishmania enriettii visceralises in the trachea, lungs, and spleen of Cavia porcellus

“…Recently, hsp70 gene has been successfully used as a tool for discriminating L. martiniquensis and L. orientalis. (30) Here, we amplified the specific fragment of this target (~1,300-bp) from DNA extracted from paraffin-embedded tissues. (25) This has allowed us to trace movement of L. enriettii from trachea to spleen in the first 8 weeks PI.…”

Amphotericin B resistance correlates with increased fitness in vitro and in vivo in Leishmania (Mundinia) martiniquensis

“…The parasite load was calculated from the mean of reciprocal positive titers divided by the weight of the homogenized cross-section and calculated as the number of parasites per gram of organ. Genomic DNA from all samples was also extracted for the detection of L. martiniquensis DNA by PCR using 70IRD/70IRM primers for the 3 ´ untranslated region (3 ´-UTR) of the heat shock protein 70 (type I) gene ( HSP70-I ) ( Jariyapan et al, 2021 ).…”

Natural infection with Leishmania (Mundinia) martiniquensis supports Culicoides peregrinus (Diptera: Ceratopogonidae) as a potential vector of leishmaniasis and characterization of a Crithidia sp. isolated from the midges

“…Host blood from engorged females was identified based on the mitochondrial cytochrome b ( cyt b ) gene sequence using the primers cyt bb1 (5 ´–CCATCMAACATYTCADC ATGAAA−3 ´) and cyt bb2 (5 ´–GCHCCTCAGAATGAYATTTG KCCTCA−3 ´) as described by Radrova et al (2013) . For molecular identification of Leishmania species in gDNA samples extracted from insects and/or cultures, primers LeF (5 ´–TCCGCCCGAAAGTTCACC GATA−3 ´) and LeR (5 ´–CCAAGTCATCCATCGCGACACG−3 ´) ( Spanakos et al, 2008 ), were used to amplify the internal transcript spacer 1 (ITS1) region (approximately 379 bp) and primers, 70-IR-D (5 ´-CCAAGGTCGAGGAGGTCGACTA-3 ´) and 70-IR-M (5 ´-ACG GGTAGGGGGAGGAAAGA −3 ´) ( Requena et al, 2012 ) were used to amplify the 3 ´untranslated region (3 ´UTR) of Leishmania HSP70 -type I ( HSP70-I ) genes as described by Jariyapan et al (2021) .…”