Molecular genetic markers of intra- and interspecific divergence within starfish and sea urchins (Echinodermata)

Петров, Н. Б.; Vladychenskaya, Irina P.; Дроздов, А. Л.; Kedrova, O. S.

doi:10.1134/s0006297916090066

Cited by 8 publications

(7 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The obtained congeneric distance range (6.9-28.1%) from this study is higher than the 8% identified in 35 freshwater fishes in Cuban (Lara et al 2010) and 10.29% from Ebonyi and Anambra States of Southeastern Nigeria (Nwani et al 2011). The identified K2P intergeneric COI sequence divergence in this study ranged from 15.800-37.00% and this value is slightly higher than the one (0.30-31.40%) reported by Iyiola et al (2018), but it is in agreement with a previous report from COI (14.6-25.7%) and inter-transcribed sequence, ITS (32.8-35.0%) (Petrov et al 2016). We obtained the highest intergeneric genetic divergence (37.00%) between Hemichromis and Parachanna, while the lowest value (15.80%) was found between Synodontis and Schilbe.…”

Section: Discussionsupporting

confidence: 91%

DNA barcoding for identification of fish species from freshwater in Enugu and Anambra States of Nigeria

Ude

Igwe

Brown

et al. 2020

Conservation Genet Resour

View full text Add to dashboard Cite

Within Enugu and Anambra States, Nigeria, identification of fishes has been based on morphological traits and do not account for existing biodiversity. For DNA barcoding, assessment of biodiversity, conservation and fishery management, 44 fish sampled from Enugu and Anambra States were isolated, amplified and sequenced with mitochondrial cytochrome oxidase subunit I (COI). Twenty groups clustering at 100% bootstrap value including monophyletic ones were identified. The phylogenetic diversity (PD) ranged from 0.0397 (Synodontis obesus) to 0.2147 (Parachanna obscura). The highest percentage of genetic distance based on Kimura 2-parameter was 37.00 ± 0.0400. Intergeneric distances ranged from 15.8000 to 37.0000%. Congeneric distances were 6.9000 ± 0.0140–28.1000 ± 0.0380, with Synodontis as the existing synonymous genus. Confamilial distances in percentage were 16.0000 ± 0.0140 and 25.7000 ± 0.0300. Forty-two haplotypes and haplotype diversity of 0.9990 ± 0.0003 were detected. Nucleotide diversity was 0.7372, while Fu and Li’s D* test statistic was 2.1743 (P < 0.02). Tajima’s D was 0.2424 (P > 0.10) and nucleotide frequencies were C (17.70%), T (29.40%), A (24.82%), G (18.04%) and A + T (54.22%). Transitional mutations were more than transversions. Twenty species (99–100%) were identified with the e-value, maximum coverage and bit-score of 1e−43, 99–100 and 185–1194, respectively. Seventeen genera and 12 families were found and Clariidae (n = 14) was the most dominant among other families. The fish species resolution, diversity assessment and phylogenetic relationships were successfully obtained with the COI marker. Clariidae had the highest number of genera and families. Phylogenetic diversity analysis identified Parachanna obscura as the most evolutionarily divergent one. This study will contribute to fishery management, and conservation of freshwater fishes in Enugu and Anambra States, Nigeria.

show abstract

Section: Discussionsupporting

confidence: 91%

DNA barcoding for identification of fish species from freshwater in Enugu and Anambra States of Nigeria

Ude

Igwe

Brown

et al. 2020

Conservation Genet Resour

View full text Add to dashboard Cite

show abstract

“…Four short fragments of cox1 , cox3 , cob , and 16S were amplified with the primers COIurF1+COIurR2 [51], cox3F+cox3R [52], cobF424+cobR876 [53], and 16SarL+16SbrH [52]. In addition, partial sequence of cox2 , nad4L , nad4 , nad5 , nad1 and nad2 were amplified with the degenerate primers designed in this study based on conserved regions of other sea cucumbers on GenBank.…”

Section: Methodsmentioning

confidence: 99%

Complete mitochondrial genome of Benthodytes marianensis (Holothuroidea: Elasipodida: Psychropotidae): Insight into deep sea adaptation in the sea cucumber

Liu

Zhang

2018

PLoS ONE

View full text Add to dashboard Cite

Complete mitochondrial genomes play important roles in studying genome evolution, phylogenetic relationships, and species identification. Sea cucumbers (Holothuroidea) are ecologically important and diverse members, living from the shallow waters to the hadal trench. In this study, we present the mitochondrial genome sequence of the sea cucumber Benthodytes marianensis collected from the Mariana Trench. To our knowledge, this is the first reported mitochondrial genome from the genus Benthodytes. This complete mitochondrial genome is 17567 bp in length and consists of 13 protein-coding genes, two ribosomal RNA genes and 22 transfer RNA genes (duplication of two tRNAs: trnL and trnS). Most of these genes are coded on the positive strand except for one protein-coding gene (nad6) and five tRNA genes which are coded on the negative strand. Two putative control regions (CRs) have been found in the B. marianensis mitogenome. We compared the order of genes from the 10 available holothurian mitogenomes and found a novel gene arrangement in B. marianensis. Phylogenetic analysis revealed that B. marianensis clustered with Peniagone sp.

show abstract

“…An 841 bp fragment from the 5' end of COI was PCR amplified using primers EchinoF1 [18] and COIer [24]. A fragment of the rDNA array was amplified using echinoderm targeting primers 18d9 and 5.8Sr, described by Petrov et al [25], which we subsequently redesigned for increased specificity towards Crossaster: 18Scro1f (GTAGGTGAACCTGCGGAAGGATC) and 5.8Scro1rev (ATG TCGATGATCACTGCGTTCTGC). The resulting~500 bp PCR product contains the variable internal transcribed spacer 1 (ITS1) of approximately 390 bp, and short flanking rDNA sequences (partial 18S,~20 bp; partial 5.8S,~100 bp); gene borders inferred from sequence comparisons to Asterias amurensis Lutken, 1871 (GenBank KX592567).…”

Section: Dna Sequence Analysesmentioning

confidence: 99%

On the genus Crossaster (Echinodermata: Asteroidea) and its distribution

Ringvold¹,

Moum

2020

PLoS ONE

View full text Add to dashboard Cite

Several starfish (Echinodermata, Asteroidea) are keystone species of marine ecosystems, but some of the species are difficult to identify using morphological criteria only. The common sunstar, Crossaster papposus (Linnaeus, 1767), is a conspicuous species with a wide circumboreal distribution. In 1900, a closely similar species, C. squamatus (Dö derlein, 1900) was described from the NE Atlantic Ocean, but subsequent authors have differed in their views on whether this is a valid taxon or rather an ecotype associated with temperature variations. We assessed the differentiating morphological characters of specimens from Norwegian and Greenland waters identified as C. papposus and C. squamatus and compared their distributions in the NE Atlantic as inferred from research cruises. The field data show that C. papposus is found mainly in temperate and shallow waters, whereas C. squamatus resides on the shelf-break in colder, mixed water masses. Intraspecific diversity and interspecific genetic differentiation of the two putative species, and their phylogenetic relationships to several Crossaster congeners worldwide, were explored using mitochondrial and nuclear DNA sequences. The molecular evidence suggests that C. papposus is the more diverse and geographically structured taxon, in line with its wide distribution. C. papposus and C. squamatus are closely related, yet clearly distinct taxa, while C. papposus and C. multispinus H.L. Clark, 1916, the latter from the South Pacific Ocean, are closely related, possibly sister taxa. PLOS ONE | https://doi.org/10.1371/journal.pone.Solasteridae family appears in the fossil record during the Lower Jurassic and with fairly clear generic characters today, according to Blake [8]. Despite this, there have been several disagreements concerning the genera Solaster and Crossaster. Agassiz proposed two genera: Solaster Forbes, 1839 and Crossaster [9] (a genus already erected by Müller and Troschel in 1840), for the two species Solaster endeca (Linnaeus, 1771) and Solaster papposus (later Crossaster papposus) [10]. A number of researchers disagreed, e.g. Viguier, Danielssen and Koren [10], Fisher (in [5], and Mortensen [11]. E.g. Fisher considered Crossaster a junior synonym of Solaster, despite the different character of the marginals, the abactinal skeleton and spinelets. Today, both genera are accepted by Clark and Downey [5] and international expert groups [6].Crossaster papposus, being a common and widely distributed species in the North Atlantic, was recognised by Carl von Linné at an early point in history. Much later, in 1900, Döderlein described a variety that differed slightly from C. papposus, and he tentatively termed it Solaster papposus var. squamata (later Crossaster squamatus (Döderlein, 1900) [12]). However, researchers have been unable to reach a consensus on whether C. squamatus should be considered a valid taxon or rather a morphotype of C. papposus [e.g. 13, 14]. So far, discrimination between the papposus and squamatus varieties has been based on morphological ch...

show abstract

Molecular genetic markers of intra- and interspecific divergence within starfish and sea urchins (Echinodermata)

Cited by 8 publications

References 16 publications

DNA barcoding for identification of fish species from freshwater in Enugu and Anambra States of Nigeria

DNA barcoding for identification of fish species from freshwater in Enugu and Anambra States of Nigeria

Complete mitochondrial genome of Benthodytes marianensis (Holothuroidea: Elasipodida: Psychropotidae): Insight into deep sea adaptation in the sea cucumber

On the genus Crossaster (Echinodermata: Asteroidea) and its distribution

Contact Info

Product

Resources

About