Molecular evidence for the occurrence of TYLCV on Mentha longifolia in Jeddah, Saudi Arabia

Abstract

Begomoviruses are whiteflies transmitted virus causing serious disease in many important plants exhibiting variable symptoms with significant economic loss globally. Mentha is an important crop being grown here in Saudi Arabia for various purposes. The begomovirus associated disease was observed on Mentha crops during field survey which were growing near to tomato field. There is no published report available about the association of begomovirus on Mentha from this region. So, this work was conducted to identify the causative agent associated with yellow vein mosaic disease. Naturally infected samples were collected from various locations and causative agent was identified by PCR using begomovirus specific primers and further cloned and sequenced bidirectionally. The full genome had total 2785 nucleotides while betasatellite molecule had 1365 nucleotides. Based on full-genome sequence analysis, the identity matrix and phylogenetic analysis showed the highest identity (99.6%) with Tomato yellow leaf curl virus (TYLCV) reported from tomato in the Kingdom of Saudi Arabia. The identified begomovirus was observed as isolate of TYLCV.

Genetic diversity of begomoviruses infecting tomato plant in Saudi Arabia

“…The purified DNA was further used for virus detection by PCR. The causal organism was identified by PCR using TYLCV(F) TAAGGGCCCGTGATTATGTTG (R) TTTATTAATTCGATATTGAATCAT(TYLCV-KT033715) and ToLCSDV (F)’GACTTGACGTCAGAGCTGGAT (R) CCAGCTCTGACGTCAAGTCAT (Sohrab and Daur, 2018a, Sohrab and Daur, 2018b). The PCR was performed at 94 °C-120 s for 1cycle, 94 °C-60 s, 50 °C-60 s, 72 °C-60 s, for 35 cycles and the final extension was given for 5 min at 72 °C.…”

“…The begomovirus infection to multiple crops has already been reported from Asia and Southeast Asia and the Arabian Peninsula (Kenyon et al, 2014). Approximately forty different plant virus diseases have been described on more than thirty plant species in Arabian Peninsula (Al-Shahwan, 2003, Idris et al, 2012, Hosseinzadeh et al, 2014, Sohrab and Daur, 2018a, Sohrab and Daur, 2018b). The association of begomovirus with various crops such as, Amaranthus, Beans, Chili, Corchorus, Cucurbits, Mint, Okra, Pumpkin, Tobacco and Tomato have been reported so far from Arabian peninsula and the associated begomoviruses are known as TYLCV, ToLCOMV, ToLCSDV, ToLCSDV-Om, ChiLCV, OLCOMV, SqLCV, and BDMV-SA (Al-Shahwan et al, 1997, Al-Shahwan et al, 2002, Ghanem et al, 2003, Idris and Brown, 2005, Ajlan et al, 2007, Khan et al, 2008, Khan et al, 2014, Fazeli et al, 2009, Idris et al, 2011, Idris et al, 2012, Idris et al, 2014, Mohamed et al, 2012, Khan et al, 2013a, Khan et al, 2013b, Al-Saleh et al, 2014a, Al-Saleh et al, 2014b, Akhtar et al, 2014, Hosseinzadeh et al, 2014, Sohrab, 2016, Sohrab et al, 2016a, Sohrab et al, 2016b, Sohrab et al, 2016c, Sohrab et al, 2016d, Sohrab et al, 2016e, Sohrab, 2017, Sayed and Sohrab, 2017, Al-Shahwan et al, 2017, Sohrab and Daur, 2018a, Sohrab and Daur, 2018b).…”

Molecular diagnosis of begomovirus associated with Chilli leaf curl disease in Jeddah, Saudi Arabia

“…The genetic diversity of and variability of TYLCV and Chilli leaf curl virus from Solanaceous crops have been reported earlier from the Kingdom of Saudi Arabia, Arabian Peninsula and South East Asia ( Idris et al, 2012 , Idris et al, 2014 , Khan et al, 2013 , Hosseinzadeh et al, 2014 , Kenyon et al, 2014 ). So far, only a few begomoviruses in the Kingdom such as TYLCV and ToLCSDV causing disease in Tomato, Cucumber, Sponge gourd, Squash, Mentha, Corchorus, Amaranthus, and Okra have been reported ( Idris et al, 2012 , Idris et al, 2014 , Al-Saleh et al, 2014 , Sohrab, 2016 , 2017a , 2017b , Sohrab, 2020 , Sohrab et al, 2016 , Sohrab and Daur, 2018a , 2018b ). The Association of ChiLCV and betasatellite infecting crops has been reported from Oman ( Khan et al, 2013 , Shahid et al, 2019 ).…”

“…The virus infection was initially confirmed by Polymerase chain reaction (PCR) using begomovirus specific coat protein gene primers. The PCR condition was followed as per earlier published paper ( Sohrab and Daur, 2018a , Sohrab and Daur, 2018b ). The PCR reaction mixture was set up with purified DNA, Taq polymerase (2.5 units) (MBI; Fermentas, USA), 10X PCR buffer (5 μl), 10 mM dNTPs (0.5 μl), forward and reverse primers (0.5 μl) (10 pmol each) and final volume was made to 50 μl by using sterile distilled water.…”

“…So far, viral diseases including begomovirus on various crops have been identified from the Arabian region and neighboring countries like; Nile Basin, Oman, Yemen, and Iran ( Al-Shahwan et al, 1997 , Ghanem et al, 2003 , Ajlan et al, 2007 , Idris et al, 2012 , Idris et al, 2014 , Khan et al, 2013 , Hosseinzadeh et al, 2014 , Al-Saleh et al, 2014 , Sohrab, 2016 , Khan and Khan, 2017 , Shahid et al, 2019 ). The begomovirus and their associated satellites infecting other crops like Amaranthus, Beans, Cucurbits, Corchorus, Mentha, Tomato and weeds have been identified earlier from the Arabian region ( Al-Shahwan et al, 1997 , Ghanem et al, 2003 , Ajlan et al, 2007 , Idris et al, 2012 , Idris et al, 2014 , Hosseinzadeh et al, 2014 , Al-Saleh et al, 2014 , Sohrab, 2016 , 2017a , 2017b , Sohrab, 2020 , Sohrab et al, 2016 , Sohrab and Daur, 2018a , 2018b ).…”