Molecular etiopathology of naturally occurring reproductive diseases in female goats

Beena,; Rvs, Pawaiya; Kumaresan, G; Dd, Singh; Mishra, Anand; Nk, Gangwar; Gupta, V. K.; Singh, Rahul; Sharma, Anil Kumar; Karikalan, M.; Kumar, Ashok

doi:10.14202/vetworld.2017.964-972

Cited by 11 publications

(7 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The occurrence of hydrosalpinx in goats is low, ranging from 0.2 to 1.1% (AL-BAGGAL et al, 1993;MAIA et al, 2018a) and can be associated with microorganisms (BEENA et al, 2017) or hydrometra (MAIA et al, 2018b). Moreover, during the ultrasound evaluation of the doe # 1, the hypoechoic heterogonous content is suggestive of salpingitis, but histopathological diagnosis was compatible with hydrosalpinx.…”

Section: Discussionmentioning

confidence: 99%

Distúrbios reprodutivos em cabras experimentalmente infectadas por Toxoplasma gondii

Wanderley

Porto

Câmara

et al. 2019

Revista Brasileira De Ciência Veterinária

View full text Add to dashboard Cite

Objetivou-se descrever os distúrbios reprodutivos associados à infecção experimental por Toxoplasma gondii através da inseminação artificial com sêmen contaminado em quatro cabras no estágio crônico da infecção. As características do trato reprodutor foram avaliadas através de ultrassonografia transretal, visando o diagnóstico gestacional ou de desordens reprodutivas, após a infecção experimental. Ao final do experimento, os animais foram necropsiados e avaliações histopatológicas e PCR foram realizados. Dentre os animais infectados que exibiram mortalidade embrionária, duas apresentaram anestro e duas apresentaram repetição de estro, sendo que destas uma apresentou intervalos entre estros reduzido (sete dias) e outra em intervalo regular (21 dias). Todavia, ambas foram submetidas a monta natural durante os estros naturais subsequentes e não foi confirmada gestação até o final do experimento (90 dias). Duas cabras exibiram alterações nos exames de ultrassonografia, sendo identificadas um cisto ovariano, e uma hidrossalpinge, ambas confirmadas no exame post-mortem. As principais lesões microscópicas nesse grupo foram infiltração neutrofílica dos pulmões, glomerulonefrite intersticial e infiltração neutrofílica do fígado. O DNA de T. gondii foi encontrado nos órgãos (coração e cérebro) de três cabras. Em conclusão, cabras infectadas com sêmen contendo T. gondii no momento da inseminação artificial apresentam distúrbios reprodutivos na fase crônica da infecção que podem estar associados à toxoplasmose.

show abstract

Section: Discussionmentioning

confidence: 99%

Distúrbios reprodutivos em cabras experimentalmente infectadas por Toxoplasma gondii

Wanderley

Porto

Câmara

et al. 2019

Revista Brasileira De Ciência Veterinária

View full text Add to dashboard Cite

show abstract

“…For Campylobacter spp., the oligonucleotides used are F: 5´‐TGTCGTCAGCTCGTGTCGTG‐3´ and R: 5´‐TCTACGATTACTAGCGATTCCG‐3´in a final 20 μl reaction mix to amplify a 276 bp PCR product (Beena et al., 2017). While, the PCR was performed for Coxiella burnetii using the 10 picomole each primers trans1: 5‐′TATGTATCCACCGTAGCCAGTC‐3′ and trans2: 5‐′CCCAACAACACCTCCTTATTC‐3′ to generate a 687bp PCR amplicon (Berri, Laroucau, & Rodolakis, 2000).…”

Section: Methodsmentioning

confidence: 99%

“…For ruling out the presence of Brucella melitensis in preputial washings of breeding bucks, OMP31-TaqMan ® probe PCR was used as per the reaction mix and thermal conditions described by Saini et al (2017) For Campylobacter spp., the oligonucleotides used are F: 5´-T GTCGTCAGCTCGTGTCGTG-3´ and R: 5´-TCTACGATTACTAGCGATT CCG-3´in a final 20 μl reaction mix to amplify a 276 bp PCR product (Beena et al, 2017). While, the PCR was performed for Coxiella burnetii using the 10 picomole each primers trans1: 5-′TATGTATCCACCGTAGCCAGTC-3′ and trans2: 5-′CCCAACAACACCTCCTTATTC-3′ to generate a 687bp PCR amplicon (Berri, Laroucau, & Rodolakis, 2000).…”

Section: Molecular Detection Of Microorganism Through Preputial Swabmentioning

confidence: 99%

Molecular detection of important abortion‐causing microorganisms in preputial swab of breeding bucks using PCR‐based assays

Gangwar

Kumaresan

Mishra

et al. 2020

Reprod Domestic Animals

View full text Add to dashboard Cite

Infectious diseases and aetiological agents related to female reproductive systems were extensively covered compared to its male counterpart. There needs a proper study to bridge this gap, where microflora and infectious agents of both male and female reproductive are mutually intelligible. With this study, we aimed to evaluate the microbial contamination of the preputial cavity and also screened for abortion-causing agents which are zoonotic as well. In goats, such types of abortions are caused by Brucella melitensis, Chlamydophila, Campylobacter and Coxiella etc. One of the major sources of contamination of semen is the preputial cavity, which is exposed to the external environment leading to spread of infection into the female via semen straws or by natural service. In the current study, good quality bucks (n = 32, Barbari = 12, Jamunapari = 10, Jakhrana = 10) which were routinely used for semen collection were screened for their preputial swabs, for the presence of the above pathogens. For detection of Brucella melitensis, OMP31 based TaqMan® probe realtime PCR assay was used, and for Chlamydia, 16srRNA gene based SYBR® green real-time PCR assay was employed for detection of Chlamydophila abortus. While for Campylobacter spp. and Coxiella burnetii, 16srRNA gene based conventional PCR and Trans-PCR were used, respectively. In the current study, of the screened preputial swabs, none of them showed positive for Brucella and Coxiella, but of the screened 32 samples 17 showed positive for Chlamydia (53.13%) and two (6.25%) showed positive for Campylobacter spp. The current study emphasizes on the farms and laboratories which were regularly involved in screening of brucellosis also often overlook the other potential non-brucella pathogens, causing abortions eventually incurring severe economic losses to the goat keepers.

show abstract

“…A sharp increase in human brucellosis in recent years has been attributed to Brucella melitensis [ 11 , 12 ], which is the species usually responsible for small ruminant brucellosis [ 13 ]. To date, a limited number of small ruminant studies have been carried out in India to understand brucellosis seroprevalence [ 1 , 14 – 16 ], but other infectious agents have been overlooked [ 17 ].…”

Section: Introductionmentioning

confidence: 99%

Risk factors for Brucella spp. and Coxiella burnetii infection among small ruminants in Eastern India

Leahy

Shome

Deka³

et al. 2020

Infection Ecology & Epidemiology

View full text Add to dashboard Cite

Small ruminants are the main reservoirs for brucellosis and coxiellosis, two zoonotic diseases affecting livestock production, and posing a public health threat in India. Understanding disease prevalence and risk factors associated with small ruminant infection can help mitigate disease transmission. We report a cross-sectional survey in the states of Assam and Odisha in Eastern India. We interviewed 244 farmers to assess knowledge, attitude and practices relevant to brucellosis and coxiellosis infection. Serum samples from 411 goats and 21 sheep were analysed using enzyme-linked immunosorbent assay and Rose-Bengal Brucella agglutination plate test. Higher Brucella and Coxiella burnetii seroprevalence were found in Odisha (22% and 11.5%, respectively) than Assam (9.8% and 1.6%, respectively), and certain districts in Odisha were at higher risk. No association was found between seropositive animals and clinical signs, a challenge when attempting to identify seropositive animals in the herd. None of the farmers interviewed were aware of brucellosis, its aetiology, clinical form, or zoonotic risk. This study acts as a first indication of the extent of these diseases among small ruminants in these Indian states, highlighting how farming practices are associated with increased risk of infection. More research is urgently needed to mitigate zoonoses transmission in this region.

show abstract

Molecular etiopathology of naturally occurring reproductive diseases in female goats

Cited by 11 publications

References 32 publications

Distúrbios reprodutivos em cabras experimentalmente infectadas por Toxoplasma gondii

Distúrbios reprodutivos em cabras experimentalmente infectadas por Toxoplasma gondii

Molecular detection of important abortion‐causing microorganisms in preputial swab of breeding bucks using PCR‐based assays

Risk factors for Brucella spp. and Coxiella burnetii infection among small ruminants in Eastern India

Contact Info

Product

Resources

About