Molecular Epidemiology of Campylobacter coli Strains Isolated from Different Sources in New Zealand between 2005 and 2014

Abstract

Campylobacteriosis is one of the most important foodborne diseases worldwide and a significant health burden in New Zealand. Campylobacter jejuni is the predominant species worldwide, accounting for approximately 90% of human cases, followed by Campylobacter coli. Most studies in New Zealand have focused on C. jejuni; hence, the impact of C. coli strains on human health is not well understood. The aim of this study was to genotype C. coli isolates collected in the Manawatu region of New Zealand from clinical cases, fresh poultry meat, ruminant feces, and environmental water sources, between 2005 and 2014, to study their population structure and estimate the contribution of each source to the burden of human disease. Campylobacter isolates were identified by PCR and typed by multilocus sequence typing. C. coli accounted for 2.9% (n ‫؍‬ 47/1,601) of Campylobacter isolates from human clinical cases, 9.6% (n ‫؍‬ 108/1,123) from poultry, 13.4% (n ‫؍‬ 49/364) from ruminants, and 6.4% (n ‫؍‬ 11/171) from water. Molecular subtyping revealed 27 different sequence types (STs), of which 18 belonged to clonal complex ST-828. ST-1581 was the most prevalent C. coli sequence type isolated from both human cases (n ‫؍‬ 12/47) and poultry (n ‫؍‬ 44/110). When classified using cladistics, all sequence types belonged to clade 1 except ST-7774, which belonged to clade 2. ST-854, ST-1590, and ST-4009 were isolated only from human cases and fresh poultry, while ST-3232 was isolated only from human cases and ruminant sources. Modeling indicated ruminants and poultry as the main sources of C. coli human infection. IMPORTANCEWe performed a molecular epidemiological study of Campylobacter coli infection in New Zealand, one of few such studies globally. This study analyzed the population genetic structure of the bacterium and included a probabilistic source attribution model covering different animal and water sources. The results are discussed in a global context.

Population structure and attribution of human clinical Campylobacter jejuni isolates from central Europe to livestock and environmental sources

“…Italian study attributed 69.75% of 56 C. jejuni isolates to chicken source, 8.25% of isolates to cattle and 6.28% of isolates to environmental sources using asymmetric island model (Di Giannatale et al., ). The same model was used also in a recent study from New Zealand, in which 55, 38 and 7% of human clinical isolates were attributed to ruminants, poultry and environmental water, respectively (Nohra et al., ).…”

Exposure to whole chicken carcasses may present a greater risk of campylobacteriosis compared to exposure to chicken drumsticks

“…Campylobacter identification was performed by molecular methods as previously described (Nohra et al., ). However, in this study, the Campylobacter isolates were identified to species level by multiplex PCR to detect the ceu E gene associated with C. coli or the hip O gene associated with C. jejuni, using the following primers: ceu E forward (5′‐AATTGAAAATTGCTCCAACTATG‐3′) and primer ceu E reverse (5′‐TGATTTTATTATTTGTAGCAGCG‐3′; Denis, Refrégier‐Petton, Laisney, Ermel, & Salvat, ), and CJF primer (5′‐ACTTCTTTATTGCTTGCTGC‐3′) and CJR primer (5′‐GCCACAACAAGTAAAGAAGC‐3′; Wang et al., ).…”

“…Campylobacter identification was performed by molecular methods as previously described (Nohra et al, 2016). However, in this study, the Campylobacter isolates were identified to species level by multiplex PCR to detect the ceuE gene associated with Impacts • Exposure to whole carcasses may present a higher risk of campylobacteriosis compared to chicken drumsticks due to differences in Campylobacter viable counts.…”

“…Amplifications were performed in 20 μl containing 0. Subtyping by MLST was performed as previously described (Nohra et al, 2016).…”

Molecular and epidemiologyical analysis of a Campylobacter jejuni outbreak in China, 2018

“…Campylobacter spp., as foodborne zoonotic pathogen, is recognized to be the leading cause of human bacterial gastroenteritis both in developed and developing countries [1][2][3]. Campylobacter is transmitted to humans through the consumption of raw milk, water, or contaminated meat, particularly in poultry [4].…”