Molecular Diversity and Relationship within Lactococcus lactis, as revealed by Randomly Amplified Polymorphic DNA (RAPD)

Tailliez, Patrick; Tremblay, Josselyne; Ehrlich, S. Dusko; Chopin, Alain

doi:10.1016/s0723-2020(98)80065-9

Cited by 66 publications

(68 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…P1, P4, and P7 generated the greatest pattern diversity and were selected for genotypic characterization. The importance of using several primers to improve the RAPD resolving power, especially when RAPD patterns generated with single primers are very similar, has been described by other authors (47). The reproducibility of the RAPD fingerprints was assessed by comparing the PCR products obtained with primers P1, P4, and P7 and DNA prepared from three separate cultures of the same strain.…”

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Characterization of Non-Starter Lactic Acid Bacteria from Italian Ewe Cheeses Based on Phenotypic, Genotypic, and Cell Wall Protein Analyses

Angelis

Corsetti

Tosti

et al. 2001

Appl Environ Microbiol

178

120

View full text Add to dashboard Cite

Non-starter lactic acid bacteria (NSLAB) were isolated from 12 Italian ewe cheeses representing six different types of cheese, which in several cases were produced by different manufacturers. A total of 400 presumptive Lactobacillus isolates were obtained, and 123 isolates and 10 type strains were subjected to phenotypic, genetic, and cell wall protein characterization analyses. Phenotypically, the cheese isolates included 32% Lactobacillus plantarum isolates, 15% L. brevis isolates, 12% L. paracasei subsp. paracasei isolates, 9% L. curvatus isolates, 6% L. fermentum isolates, 6% L. casei subsp. casei isolates, 5% L. pentosus isolates, 3% L. casei subsp. pseudoplantarum isolates, and 1% L. rhamnosus isolates. Eleven percent of the isolates were not phenotypically identified. Although a randomly amplified polymorphic DNA (RAPD) analysis based on three primers and clustering by the unweighted pair group method with arithmetic average (UPGMA) was useful for partially differentiating the 10 type strains, it did not provide a species-specific DNA band or a combination of bands which permitted complete separation of all the species considered. In contrast, sodium dodecyl sulfate-polyacrylamide gel electrophoresis cell wall protein profiles clustered by UPGMA were species specific and resolved the NSLAB. The only exceptions were isolates phenotypically identified as L. plantarum and L. pentosus or as L. casei subsp. casei and L. paracasei subsp. paracasei, which were grouped together. Based on protein profiles, Italian ewe cheeses frequently contained four different species and 3 to 16 strains. In general, the cheeses produced from raw ewe milk contained a larger number of more diverse strains than the cheeses produced from pasteurized milk. The same cheese produced in different factories contained different species, as well as strains that belonged to the same species but grouped in different RAPD clusters.Non-starter lactic acid bacteria (NSLAB) usually increase from a low number in fresh curd to dominate the microflora of mature cheese (36). In contrast to starters, NSLAB tolerate the hostile environment of cheese during ripening; this environment typically is characterized by 32 to 39% moisture, 4 to 6% salt in moisture, pH 4.9 to 5.3, 5 to 13°C, and a deficiency of nutrients (15,48). Mesophilic lactobacilli predominate in the NSLAB community, although pediococci and micrococci may also be found (6,11,15). Lactobacillus casei subsp. casei, L. casei subsp. pseudoplantarum, Lactobacillus paracasei subsp. paracasei, and Lactobacillus plantarum are the most frequently isolated taxa, but other facultatively and obligately heterofermentative species of lactobacilli are also found (18, 28). Adventitious mesophilic lactobacilli are usually present because of postpasteurization contamination but may also constitute part of the raw milk microflora and survive pasteurization (48).The role of NSLAB in ripening has not been resolved satisfactorily yet, although inclusion of adjunct cultures of some strains of NSLAB or use of ra...

show abstract

Section: Resultsmentioning

confidence: 99%

“…Other studies (11,33,40,46,47) have used RAPD analysis to differentiate strains belonging to a limited number of species of lactobacilli, lactococci, and propionibacteria. Fitzsimons et al (11) were the first workers to use this technique to study NSLAB from Cheddar cheeses.…”

Section: Discussionmentioning

confidence: 99%

Characterization of Non-Starter Lactic Acid Bacteria from Italian Ewe Cheeses Based on Phenotypic, Genotypic, and Cell Wall Protein Analyses

Angelis

Corsetti

Tosti

et al. 2001

Appl Environ Microbiol

178

120

View full text Add to dashboard Cite

show abstract

“…lactis and L. lactis subsp. cremoris strains IL-1403, IL-582, IL801, IL896, Z105, Z106, and Z191 (CNRZ strain collection; kindly provided by P. Tailliez [37]). The two subspecies are closely related (over 80% identity between the subspecies strains, as determined using BLAST for gene analogues).…”

Section: Methodsmentioning

confidence: 99%

Respiration Capacity of the Fermenting Bacterium Lactococcus lactis and Its Positive Effects on Growth and Survival

et al. 2001

View full text Add to dashboard Cite

Oxygen is a major determinant of both survival and mortality of aerobic organisms. For the facultative anaerobe Lactococcus lactis, oxygen has negative effects on both growth and survival. We show here that oxygen can be beneficial to L. lactis if heme is present during aerated growth. The growth period is extended and long-term survival is markedly improved compared to results obtained under the usual fermentation conditions. We considered that improved growth and survival could be due to the capacity of L. lactis to undergo respiration. To test this idea, we confirmed that the metabolic behavior of lactococci in the presence of oxygen and hemin is consistent with respiration and is most pronounced late in growth. We then used a genetic approach to show the following. (i) The cydA gene, encoding cytochrome d oxidase, is required for respiration and plays a direct role in oxygen utilization. cydA expression is induced late in growth under respiration conditions. (ii) The hemZ gene, encoding ferrochelatase, which converts protoporphyrin IX to heme, is needed for respiration if the precursor, rather than the final heme product, is present in the medium. Surprisingly, survival improved by respiration is observed in a superoxide dismutase-deficient strain, a result which emphasizes the physiological differences between fermenting and respiring lactococci. These studies confirm respiratory metabolism in L. lactis and suggest that this organism may be better adapted to respiration than to traditional fermentative metabolism.The toxic cellular effects of oxygen are a major factor in aging and mortality (3, 28). Oxygen toxicity is attributed to the activity of reactive oxygen species that attack proteins, lipids, and nucleic acids (15). Effects of oxygen have been extensively studied by use of bacterial models, principally with the facultatively respiring bacterium Escherichia coli (see references 7 and 13 for reviews). In this model, respiration itself is implicated as a source of oxidative damage in E. coli (8, 9, 18, 20, 27, and 36). It has been suggested that the shutdown of respiration in nutrient-limited conditions may reduce reactive oxygen species levels and thereby improve E. coli survival. Recent evidence further suggests that survival is favored by shifting cells to anaerobic conditions during entry into stationary phase (9).Current information on the effects of oxygen is mainly based on respiring organisms. As such, the question of what anaerobes do in the presence of oxidative stress has been explored little. It is presumed that these organisms cope with stress in much the same way as aerobes, except that their defense systems, which may include superoxide dismutases (SODs) and catalases, may be more limited. However, there has been no demonstration to date that responses of anaerobes to an oxidative environment are predictable from the behavior of respiring bacteria.The effects of oxygen have been examined with Lactococcus lactis, a gram-positive facultative anaerobe with a fermentative metabolism that ca...

show abstract

“…The nucleotide sequences of the amplified products of the L. lactis comX, htrA, Table and were previously characterized by randomly amplified polymorphic DNA (19). The primers used to amplify the genes follow: for ycdB Lac , ATGGGACGTAAATGGGCCAATATT and GAGATTTGCAACGTTATGATAAACTT; for comX, ACTTGCTGA AATCGTTGAAGG and GTTCGTCCTGAGCCAGGATC; for htrA, AGGTATTATTAAGTGAGAGTAG and GCACGACCAATTCCTGA ATG; for mutX (IL1403), GGGACTCCCCAATAAGTATCATG and TATGCTGGGATTGCTCGTAAAGC; and for mutX (MG1363), GTGC TCCCCAATAGGTATCATGA and TATGCTGGGATTGCTCGTAAAGC.…”

mentioning

confidence: 99%

Recent Genetic Transfer between Lactococcus lactis and Enterobacteria

et al. 2004

View full text Add to dashboard Cite

The genome sequence of Lactococcus lactis revealed that the ycdB gene was recently exchanged between lactococci and enterobacteria. The present study of ycdB orthologs suggests that L. lactis was probably the gene donor and reveals three instances of gene transfer to enterobacteria. Analysis of ycdB gene transfer between two L. lactis subspecies, L. lactis subsp. lactis and L. lactis subsp. cremoris, indicates that the gene can be mobilized, possibly by conjugation.Horizontal gene transfer between distant species is an important factor in prokaryotic evolution (for recent reviews, see references 8, 12, and 15). Genome analysis of Lactococcus lactis IL1403 suggested a relatively recent horizontal transfer of a gene between lactococci and gram-negative enterobacteria (4). The gene, ycdB, encodes a protein of unknown function, containing an PFAM DUF028 domain. Such proteins are ubiquitous in Eubacteria, present in Eucaryota, but absent in Archaea. Fully sequenced genomes of Escherichia coli and Shigella and Salmonella species have two DUF028 domain genes, yeeN and yebC, encoding proteins that have ϳ96 and ϳ40% of identity, respectively, to the YcdB protein of L. lactis IL1403. Divergence of the enterobacterial yeeN gene (which we designate ycdB Ent hereafter) and the lactococcal ycdB gene (ycdB Lac ) at synonymous nucleotide positions, where the mutations do not change the encoded amino acid, is about 10%, suggesting that the transfer could have taken place only about ten million years ago (4). Here we address the possibility that the transfer involved another lactococcal species and could have occurred more recently by examining the ycdB Lac genes of a number of strains belonging to different lactococcal species. We also address the question of the mechanism of transfer by examining exchange of the gene between two subspecies of L. lactis, namely, L. lactis subsp. lactis and L. lactis subsp. cremoris (7, 13).Enterobacterial ycdB orthologs were acquired from L. lactis. We sequenced the ycdB Lac orthologs of 70 strains belonging to four different Lactococcus taxa (L. lactis, Lactococcus plantarum, Lactococcus garviae, and Lactococcus raffinolactis) and compared their sequences with ycdB Ent DNA sequences of gram-negative enterobacteria, which included Escherichia, Shigella, and Salmonella strains. The phylogenetic tree based on these results is shown in Fig. 1

show abstract

Molecular Diversity and Relationship within Lactococcus lactis, as revealed by Randomly Amplified Polymorphic DNA (RAPD)

Cited by 66 publications

References 39 publications

Characterization of Non-Starter Lactic Acid Bacteria from Italian Ewe Cheeses Based on Phenotypic, Genotypic, and Cell Wall Protein Analyses

Characterization of Non-Starter Lactic Acid Bacteria from Italian Ewe Cheeses Based on Phenotypic, Genotypic, and Cell Wall Protein Analyses

Respiration Capacity of the Fermenting Bacterium Lactococcus lactis and Its Positive Effects on Growth and Survival

Recent Genetic Transfer between Lactococcus lactis and Enterobacteria

Contact Info

Product

Resources

About