Molecular dissection of QTL governing grain size traits employing association and linkage mapping in Basmati rice

Deborah, Dondapati Annekitty; Vemireddy, Lakshminarayana R.; Veeraghattapu, Roja; Patil, S.; Choudhary, Ganga Prasad; Noor, Sabahat; Srividhya, A.; Kaliappan, A.; Rani, B Sandhya; Satyavathi, Valluri V.; Anuradha, G.; Radhika, K.; Yamini, K.N.; Kadambari, Gopalakrishna; Nagireddy, Ranjith K; Siddiq, E. A.; Nagaraju, Javaregowda

doi:10.1007/s11032-017-0678-9

Cited by 8 publications

(4 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The linkage mapping and GWAS (genome wide association studies) analysis are the two main methods to determine the gene/QTL loci for key agronomic traits in crops. In recent years, integration of linkage mapping and association mapping have been successfully applied in rice [ 19 ], cotton [ 20 ], rapeseed [ 21 ], sunflower [ 22 ], soybean [ 23 , 24 ] for detection of QTLs and candidate genes linked to specific complex agricultural traits. Therefore, in the present study, we sequenced the 130 F 2 individuals derived from a cross between the curly leaf mutant cl1 and the wild type, and identified the target gene SiCL1 alleles in sesame using the cross-population association mapping and the genome variants screening.…”

Section: Introductionmentioning

confidence: 99%

Identification of a SiCL1 gene controlling leaf curling and capsule indehiscence in sesame via cross-population association mapping and genomic variants screening

et al. 2018

View full text Add to dashboard Cite

BackgroundLeaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied.ResultsFor cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553–6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed.ConclusionsSiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.Electronic supplementary materialThe online version of this article (10.1186/s12870-018-1503-2) contains supplementary material, which is available to authorized users.

show abstract

Section: Introductionmentioning

confidence: 99%

Identification of a SiCL1 gene controlling leaf curling and capsule indehiscence in sesame via cross-population association mapping and genomic variants screening

et al. 2018

View full text Add to dashboard Cite

show abstract

“…Integration of linkage mapping with association mapping has been recently applied to identify quantitative trait loci and candidate genes controlling complex agricultural traits in sesame and other crops (Cadic et al., 2013; Deborah et al., 2017; Duan et al., 2021; Korir et al., 2013; Shi et al., 2015; Y. Zhao et al., 2014). In particular, the high‐quality sesame reference genome, genome variant data, cross‐population association mapping, and genomic variant screening method (H. Zhang et al., 2018) have been successfully used to identify several key mutated genes in sesame, such as SiCL1 controlling curly leaf and indehiscent capsule traits, SiCRC regulating capsule size, and SiDWF1 controlling step internode length (Miao et al., 2020; Wei et al., 2019; H. Zhang et al., 2018).…”

Section: Discussionmentioning

confidence: 99%

Section: Identification Of Si4cll1 Via Association Mappingmentioning

confidence: 99%

Identification and functional characterization of Si4CLL1 controlling the male sterility in the sesame genic male sterile mutant, ms1812

Guo,

Miao,

et al. 2023

Crop Science

View full text Add to dashboard Cite

Sesame (Sesamum indicum L.), 2n = 2x = 26, is an important oilseed crop with high heterosis potential. In this study, we explored the histological and genetic characters and causal gene of a male sterile sesame mutant, ms1812 (ms3). The microspore abortion of ms1812 that led to male sterility (MS) occurred at the tetrad stage of microspore development. No normal pollens were formed and observed in anther chambers of ms1812 at the microspore mature stage. With the aid of high‐efficient association mapping and the sesame var. Yuzhi 11 reference genome, we identified the single nucleotide polymorphism 10505640 on SiChr.3 segregating with the MS and the mutated gene, Si4cll1, controlling the recessive MS in sesame. Si4CLL1 encodes a 4‐coumarate‐CoA ligase‐like protein. The 1292th nucleotide (T1292) of Si4CLL1 mutated into A1292, resulting in the amino acid change from Ile239 to Lys239. Si4CLL1 is mainly expressed in young developing buds. Compared with the wild type, the transcript abundance of Si4cll1 in the developing buds of ms1812 reduced significantly, which might affect the phenylpropanoid biosynthesis pathway and finally, the lignin formation of microspore cell wall. These findings provide key new information for deciphering the molecular mechanism underlying MS and hybrid variety breeding assisted by MS in sesame.

show abstract

“…Os10g0483500 (cytokinin dehydrogenase 3) and Os05g0374200 (cytokinin dehydrogenase 9) were both found upregulated in highly aromatic RIL bulks. Deborah et al (2017) pointed out that Os05g0374200 (similar to cytokinin dehydrogenase 1 precursor) was involved in the accumulation of cytokinins and influenced the grain size. The expression of Os02g0613900 (adenine phosphoribosyltransferase 4, APRT) gene was also upregulated in highly aromatic RIL bulks as shown by our analysis.…”

Section: Gene Ontology Enrichment Analysis Of the Differentially Exprmentioning

confidence: 99%

Identification of candidate genes related to aroma in rice by analyzing the microarray data of highly aromatic and nonaromatic recombinant inbred line bulks

Zinati

Delavari

2019

bta

View full text Add to dashboard Cite

Aroma is an important factor affecting the rice quality. However, the breeding strategies for improving aroma, the molecular basis of the aroma formation, and aroma-related genes are yet to be investigated. In this study, microarray analysis was performed followed by gene ontology (GO) enrichment analysis and protein-protein interaction (PPI) network analysis for discovering the differentially expressed genes in the bulks of an aromatic and a nonaromatic recombinant inbred line (RIL) derived from a cross between a basmati rice variety, Pusa 1121, and a nonaromatic rice variety, Pusa 1342. GO enrichment analysis categorized a total of 2577 differentially expressed genes into 24 functional groups. The metabolic process was the most highly overrepresented category enriched by the differentially expressed genes. One of the most paramount minor subcategories in the metabolic process category was "cellular aromatic compound metabolic process (GO: 0006725)" with 21 genes that may serve as novel candidates for genes involved in aroma formation. According to the network analysis, six downregulated genes, as well as two upregulated genes, were identified as critical in the PPI network. These results will provide a perspective for unveiling the key components of the mechanisms behind the aroma formation in rice and give the required information on client-oriented breeding.

show abstract

Molecular dissection of QTL governing grain size traits employing association and linkage mapping in Basmati rice

Cited by 8 publications

References 29 publications

Identification of a SiCL1 gene controlling leaf curling and capsule indehiscence in sesame via cross-population association mapping and genomic variants screening

Identification of a SiCL1 gene controlling leaf curling and capsule indehiscence in sesame via cross-population association mapping and genomic variants screening

Identification and functional characterization of Si4CLL1 controlling the male sterility in the sesame genic male sterile mutant, ms1812

Identification of candidate genes related to aroma in rice by analyzing the microarray data of highly aromatic and nonaromatic recombinant inbred line bulks

Contact Info

Product

Resources

About