Molecular cloning and primary structure of the human blood group RhD polypeptide.

Abstract

The RH (rhesus) blood group locus from RhD-positive donors is composed of two homologous structural genes, one of which encodes the Cc and Ee polypeptides, whereas the other, which is missing in the RhD-negative condition, encodes the D protein that carries the major antigen of the RH system. Recently, different splicing isoforms transcribed from the CcEe gene were isolated. We report now the characterization of two other Rh clones, RhII and RhXIII, generated by alternative choices for poly(A) addition sites that were identified as the RhD gene transcripts. That these cDNAs represented the RhD messenger and that the previously described Rh clones were derived from the CcEe gene was demonstrated by amplification of RhII/XIII sequences only from D-positive genomes and by cloning and sequencing of D- and CcEe-specific gene fragments. The predicted translation product of the RhD mRNA is a 417-amino acid protein (M(r) = 45,500) that exhibited a similar membrane organization with 13 bilayer-spanning domains compared with the polypeptide encoded by the CcEe gene. The D and Cc/Ee polypeptides differ by 36 amino acid substitutions (8.4% divergence), but the NH2- and COOH-terminal regions of the two proteins are well conserved. Similarly, five of the six cysteine residues of the Cc/Ee proteins were conserved in the D protein, including the unique exofacial cysteine, which is critical for antigenic reactivity. The sequence homology between the Cc/Ee and D proteins supports the concept that the genes encoding these polypeptides have evolved by duplication of a common ancestor gene.

Specificity and sensitivity of RHD genotyping methods by PCR‐based DNA amplification

“…These parameters have not been investigated in previous studies and should help in the selection of methods for reliable RHD genotyping of fetal cells. The primers used in the PCR assays for methods I-III were derived to selectively amplify D-specific sequences, based on the known nucleotide polymorphisms of RHD v RHCE genes (Cherif-Zahar et al, 1990;Le van Kim et al, 1992), whereas those used in method IV were located in exons 4 and 5, respectively, so as to amplify a 1200 bp intron containing fragment from the RHCE gene and a 600 bp intron fragment from the RHD gene, as first shown by Arce et al (1993).…”

“…Oligonucleotide primers used in the Rh-specific PCR assays are described in Table I. The primers D4 and D5 used in method I, were derived from the PCR system of Le Van Kim et al (1992) and Bennett et al (1993). The D4 forward primer was derived from primer A3 which has been 5 0 -extended with six additional bases to increase the PCR annealing temperature to 58ЊC, and the reverse primer D5 was chosen 99 bases 3 0 downstrean to the initial RhXIII/A4 primer and corresponded to primers RDA3/RD2 of Lo et al (1993).…”

Molecular basis of the D variant phenotypes DNU and DII allows localization of critical amino acids required for expression of Rh D epitopes epD3, 4 and 9 to the sixth external domain of the Rh D protein

“…The erythrocyte Rh D antigen is expressed on a 30 kD membrane protein with multiple membrane traversing hydrophobic segments (Le van Kim et al, 1992;Arce et al, 1993). The protein has close homology to the Rh CcEe proteins with 35 or 36 amino acid substitutions (Avent et al, 1990;Cherif-Zahar et al, 1990).…”

Molecular determination of RhD phenotype by DNA typing: clinical applications

“…The PCR product obtained from the RHCE gene (1238 bp) is distinguished from that obtained from the RHD gene because in the latter there is a deletion in intron 4 that results in a smaller PCR product (587 bp). We designed the other set of primers based on published RHCE and RHD sequence data 3,4 to analyse exon 10 of the RHD gene; 11,15 Rh1228 for a sequence located in exon 10 of both RH genes (5 TTTCCTCATTTGGCTGTTG 3 , sense primer, position 1228±1246); and Rh1478 for a sequence located in the 3 non-coding region of the RHD gene (5 CATGGCTGTATTTTATTGTTGTAT 3 , antisense primer, position 1478±1455). This pair of primers yields a PCR product of 250 bp only from the RHD gene.…”

“…Each gene consists of 10 exons with 92% sequence homology between them. 3,4 The molecular basis for RhD-positive and RhDnegative blood type is the presence or absence of the RHD gene, rather than the hypothetical d allele. That is, RhD-positive individuals have either one or two RHD genes per cell whereas the RhD-negative phenotype is caused by the absence of the entire RHD gene or at least part of it.…”