Molecular Cloning and Functional Characterization of a Novel Human CC Chemokine Receptor (CCR5) for RANTES, MIP-1β, and MIP-1α

Raport, Carol J.; Gosling, J. A.; Schweickart, Vicki L.; Gray, Patrick W.; Charo, Israel F.

doi:10.1074/jbc.271.29.17161

Cited by 422 publications

(328 citation statements)

References 39 publications

Supporting

Mentioning

307

Contrasting

Unclassified

Order By: Relevance

“…The primer sequences were as follows: sense, ATCACTTGGGTGGTGG CTGTGTTTGCGT CTC; antisense, AGTAGCAGAT GACCATGACAAGCAGCGGCAG, corresponding to bases 505-535 and 667-697, respectively, of the published sequence. 59 Cycling conditions were as follows: 941C for 5 min, followed by 30 cycles of 941C, 30 s; 701C, 30 s with a 1 s increment per cycle, using an MJ research thermal cycler. The polymorphism was detected following electrophoresis of the products in 10% polyacrylamide gels, staining with ethidium bromide and visualization on a UV transilluminator.…”

Section: Dna Extractionmentioning

confidence: 99%

CCR5-Δ32 mutation is strongly associated with primary sclerosing cholangitis

et al. 2004

View full text Add to dashboard Cite

Section: Dna Extractionmentioning

confidence: 99%

CCR5-Δ32 mutation is strongly associated with primary sclerosing cholangitis

et al. 2004

View full text Add to dashboard Cite

“…RANTES secretion has also been demonstrated in T cells surrounding multiple sclerosis lesions of the human brain (6). The importance of RANTES in virus-induced pathogenesis was emphasized by the finding that infection of CD4 ϩ T cells by M-tropic strains of HIV-1 is antagonized by the chemokines RANTES, macrophage-inflammatory protein-1␣, and macrophage-inflammatory protein-1␤, the natural ligands of HIV fusion cofactor CCR5 chemokine receptor (7)(8)(9). Interestingly, RANTES is also targeted by another unrelated virus, human CMV, which encodes a homologue of a CC chemokine receptor gene (US28) that is capable of binding RANTES (10,11).…”

Section: Regulation Of Rantes Chemokine Gene Expression Requiresmentioning

confidence: 99%

Regulation of RANTES Chemokine Gene Expression Requires Cooperativity Between NF-κB and IFN-Regulatory Factor Transcription Factors

Génin

Algarté

Roof

et al. 2000

The Journal of Immunology

206

208

View full text Add to dashboard Cite

Virus infection of host cells activates a set of cellular genes, including cytokines, IFNs, and chemokines, involved in antiviral defense and immune activation. Previous studies demonstrated that virus-induced transcriptional activation of a member of the human CC-chemokine RANTES required activation of the latent transcription factors IFN-regulatory factor (IRF)-3 and NF-κB via posttranslational phosphorylation. In the present study, we further characterized the regulatory control of RANTES transcription during virus infection using in vivo genomic footprinting analyses. IRF-3, the related IRF-7, and NF-κB are identified as important in vivo binding factors required for the cooperative induction of RANTES transcription after virus infection. Using fibroblastic or myeloid cells, we demonstrate that the kinetics and strength of RANTES virus-induced transcription are highly dependent on the preexistence of IRFs and NF-κB. Use of dominant negative mutants of either IκB-α or IRF-3 demonstrate that disruption of either pathway dramatically abolishes the ability of the other to bind and activate RANTES expression. Furthermore, coexpression of IRF-3, IRF-7, and p65/p50 leads to synergistic activation of RANTES promoter transcription. These studies reveal a model of virus-mediated RANTES promoter activation that involves cooperative synergism between IRF-3/IRF-7 and NF-κB factors.

show abstract

“…CCR5 binds to multiple chemokines including CCL3, CCL4/ MIP-1b, and CCL5 [19,20]. CCR5-deficient (CCR5 -/-) mice exhibited reduced numbers of infiltrating leukocytes upon infection with parasites and viruses, compared with wild-type mice, with changes in susceptibility to these pathogens [21][22][23][24][25][26].…”

Section: Introductionmentioning

confidence: 99%

Role of C‐C chemokine receptors 1 and 5 and CCL3/macrophage inflammatory protein‐1α in the cutaneous Arthus reaction: possible attenuation of their inhibitory effects by compensatory chemokine production

et al. 2004

View full text Add to dashboard Cite

The deposition of immune complexes induces an acute inflammatory response with tissue injury. Immune complex-induced tissue injury is mediated by inflammatory cell infiltration that is highly regulated by multiple chemokines. To assess the role of the chemokine receptors CCR1 and CCR5, and a ligand for these receptors CCL3/macrophage inflammatory protein1a, in this pathogenic process, the reverse passive cutaneous Arthus reaction was induced in mice lacking CCR1, CCR5, or CCL3. Edema was significantly attenuated in CCR1-deficient (CCR1 -/-) and CCL3 -/-mice but not CCR5 -/-mice, compared with wild-type mice. Numbers of infiltrating neutrophils and mast cells were reduced in CCL3 -/-and CCR1 -/-mice, respectively, compared with wild-type mice. CCR1 and CCR5 were expressed on neutrophils and mast cells. Remarkably, the intradermal mRNA expression of CCL5/RANTES, another ligand for CCR1 and CCR5, was increased in CCR5 -/-and CCL3 -/-mice, compared with wild-type mice, while the cutaneous CCL3 mRNA expression was augmented in CCR1 -/-and CCR5 -/-mice. These results indicate that CCR1, CCR5, and CCL3 cooperatively contribute to the cutaneous Arthus reaction, and also suggest that enhanced expression of CCL3 and CCL5 compensates for the loss of CCR1, CCR5, and CCL3 in the reaction.

show abstract

Molecular Cloning and Functional Characterization of a Novel Human CC Chemokine Receptor (CCR5) for RANTES, MIP-1β, and MIP-1α

Cited by 422 publications

References 39 publications

CCR5-Δ32 mutation is strongly associated with primary sclerosing cholangitis

CCR5-Δ32 mutation is strongly associated with primary sclerosing cholangitis

Regulation of RANTES Chemokine Gene Expression Requires Cooperativity Between NF-κB and IFN-Regulatory Factor Transcription Factors

Role of C‐C chemokine receptors 1 and 5 and CCL3/macrophage inflammatory protein‐1α in the cutaneous Arthus reaction: possible attenuation of their inhibitory effects by compensatory chemokine production

Contact Info

Product

Resources

About