Molecular characterization of H6 subtype influenza viruses in southern China from 2009 to 2011

Zou, Shumei; Gao, Rongbao; Zhang, Ye; Li, Xiaodan; Chen, Wenbing; Bai, Tian; Dong, Libo; Wang, Dayan; Shu, Yuelong

doi:10.1038/emi.2016.71

Cited by 26 publications

(22 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…H6 hemagglutinin-pHH21 was synthesized by Genscript ( www.genscript.com ) in the pHH21 vector. The H6 HA coding sequence from A/Environment/Hubei-Jinzhou/02/2010 [ 49 ] was inserted into pHH21 flanked by human H3 5’ ( GCAAAAGCAGGGGATAATTCTATTAACC ) and 3’ ( TAAGAGTGCATTAATTAAAAACACCCTTGTTTCTACTAA ) UTR sequences. After gene synthesis, two mutations (Q223L and G225S) were added in the HA coding sequence to increase HA protein binding to 2,6 sialic acid [ 50 ].…”

Section: Methodsmentioning

confidence: 99%

Neuraminidase antigenic drift of H3N2 clade 3c.2a viruses alters virus replication, enzymatic activity and inhibitory antibody binding

Powell

Pekosz

2020

PLoS Pathog

View full text Add to dashboard Cite

In the 2014-2015 influenza season a novel neuraminidase (NA) genotype was detected in global human influenza A surveillance. This novel genotype encoded an N-linked glycosylation site at position 245-247 in the NA protein from clade 3c.2a H3N2 viruses. In the years following the 2014-2015 season, this novel NA glycosylation genotype quickly dominated the human H3N2 population of viruses. To assess the effect this novel N-linked glycan has on virus fitness and antibody binding, recombinant viruses with (NA Gly+) or without (NA Gly-) the 245 NA glycan were created. Viruses with the 245 NA Gly+ genotype grew to a significantly lower infectious virus titer on primary, differentiated human nasal epithelial cells (hNEC) compared to viruses with the 245 NA Gly-genotype, but growth was similar on immortalized cells. The 245 NA Gly+ blocked human and rabbit monoclonal antibodies that target the enzymatic site from binding to their epitope. Additionally, viruses with the 245 NA Gly+ genotype had significantly lower enzymatic activity compared to viruses with the 245 NA Gly-genotype. Human monoclonal antibodies that target residues near the 245 NA glycan were less effective at inhibiting NA enzymatic activity and virus replication of viruses encoding an NA Gly+ protein compared to ones encoding NA Gly-protein. Additionally, a recombinant H6N2 virus with the 245 NA Gly+ protein was more resistant to enzymatic inhibition from convalescent serum from H3N2-infected humans compared to viruses with the 245 NA Gly-genotype. Finally, the 245 NA Gly+ protected from NA antibody mediated virus neutralization. These results suggest that while the 245 NA Gly+ decreases virus replication in hNECs and decreases enzymatic activity, the 245 NA glycan blocks the binding of monoclonal and human serum NA specific antibodies that would otherwise inhibit enzymatic activity and virus replication.

show abstract

Section: Methodsmentioning

confidence: 99%

Neuraminidase antigenic drift of H3N2 clade 3c.2a viruses alters virus replication, enzymatic activity and inhibitory antibody binding

Powell

Pekosz

2020

PLoS Pathog

View full text Add to dashboard Cite

show abstract

“…Nucleotide sequences were edited using the SeqMan module of the DNASTAR package, and multiple sequence alignments were compiled using Clustal W [ 22 – 24 ]. Phylogenetic analyses were performed with the neighbour-joining method with maximum likelihood trees using MEGA 6.0 software [ 25 , 26 ]. Bootstrap values of 1,000 were used.…”

Section: Methodsmentioning

confidence: 99%

New H6 influenza virus reassortment strains isolated from Anser fabalis in Anhui Province, China

Chai

Fan

et al. 2017

Virol J

View full text Add to dashboard Cite

BackgroundH6 subtype avian influenza viruses are globally distributed and, in recent years, have been isolated with increasing frequency from both domestic and wild bird species as well as infected humans. Many reports have examined the viruses in the context of poultry or several wild bird species, but there is less information regarding their presence in migratory birds.MethodsHemagglutination and hemagglutination inhibition tests were used to measure HA activity for different HA subtypes. Whole viral genomes were sequenced and analysed using DNAstar and MEGA 6 to understand their genetic evolution. Pathogenicity was evaluated using a mouse infection model.ResultsWe isolated 13 strains of H6 virus from faecal samples of migratory waterfowl in Anhui Province of China in 2014. Phylogenetic analysis showed gene reassortment between Eurasian and North American lineages. Five of the identified H6 strains had the ability to infect mice without adaptation.ConclusionOur findings suggest that regular surveillance of wild birds, especially migratory birds, is important for providing early warning and control of avian influenza outbreaks.

show abstract

“…The properties of receptor binding were distinguished by virus hemagglutination difference. The treatment detail of blood cells was taken as reference [ 12 ]. Original 10% TRBC suspension in phosphate buffer solution (PBS) was treated by 625mUα2,3 specific sialidase (Takara Dalian, China) at 37°Cfor 30 min.…”

Section: Methodsmentioning

confidence: 99%

Characteristics of influenza H13N8 subtype virus firstly isolated from Qinghai Lake Region, China

Dong¹,

Zhang

et al. 2017

Virol J

Self Cite

View full text Add to dashboard Cite

BackgroundSince the highly pathogenic H5N1 influenza caused thousands of deaths of wild bird in this area in 2005, Qinghai Lake in China has become a hot spot for study of the influence of avian influenza to migratory wild birds. However, the ecology and evolution of low pathogenic avian influenza virus in this region are limited. This project-based avian influenza surveillance in Qinghai lake region was initiated in year 2012.MethodSamples of wild bird feces and lake surface water were collected in Qinghai Lake in year 2012.Virus isolation was conducted on embryonated chicken eggs. The influenza A virus was determined by rRT-PCR. Virus sequences were acquired by deep sequencing. The phylogenetic correlation and molecular characteristics of the viruses were analyzed. The virus growth and infection features, receptor binding preference were studied, and pathogenicity in vitro as well as.ResultsTwo H13N8 subtype influenza viruses were isolated. The viruses are phylogenetically belong to Eurasian lineage. Most of the genes are associated with gull origin influenza virus except PB1 gene, which is most probably derived from Anseriformes virus. The evidence of interspecies reassortment was presented. The two viruses have limited growth capacity on MDCK and A549 cells while grow well in embryonated eggs. The dual receptor binding features of the two viruses was shown up. The low pathogenic features were determined by trypsin dependence plaque formation assay.ConclusionsThe two H13N8 subtype influenza viruses are highly associated with gull origin. The interspecies reassortment of H13 subtype virus among Anseriforme sand Charadriiformes wild birds emphasizes the importance of strengthening avian influenza surveillance in this region. This study is helpful to understand the ecology, evolution and transmission pattern of H13 subtype influenza virus globally.Electronic supplementary materialThe online version of this article (10.1186/s12985-017-0842-1) contains supplementary material, which is available to authorized users.

show abstract

Molecular characterization of H6 subtype influenza viruses in southern China from 2009 to 2011

Cited by 26 publications

References 46 publications

Neuraminidase antigenic drift of H3N2 clade 3c.2a viruses alters virus replication, enzymatic activity and inhibitory antibody binding

Neuraminidase antigenic drift of H3N2 clade 3c.2a viruses alters virus replication, enzymatic activity and inhibitory antibody binding

New H6 influenza virus reassortment strains isolated from Anser fabalis in Anhui Province, China

Characteristics of influenza H13N8 subtype virus firstly isolated from Qinghai Lake Region, China

Contact Info

Product

Resources

About