Molecular Characterization of Genetically Manipulated Plants

Lacorte, Cristiano; Vianna, Giovanni R.; Aragão, F. J. L.; Rech, E. L.; Davey, M. R.; Anthony, Paul

doi:10.1002/9780470686522.ch14

Cited by 4 publications

(2 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Leaf tissues (100 mg) were macerated in 300 µl of phosphate‐buffered saline (PBS) for 15 s. Then, an immunostrip was inserted into the microtube and read after 10 min of incubation when positive results may be visible. The presence of the ThSMase transgene was verified by PCR (according to Lacorte et al, 2010), using the primer pair Sphingo973F (5′‐TGGACAAGATGGGTTGGAGC‐3′), and Sphingo1344R (5′‐GCCATAACAGCATGAGAAGCA‐3′) to amplify a 371 bp region within the ThSMase coding sequence. PCR conditions were 95°C (5 min) denaturation; 35 cycles of 95°C for 1 min, 55°C for 1 min and 72°C for 2 min; and a final elongation cycle of 7 min at 72°C.…”

Section: Methodsmentioning

confidence: 99%

“…Leaf tissues (100 mg) were macerated in 300 µl of phosphate-buffered saline (PBS) for 15 s. Then, an immunostrip was inserted into the microtube and read after 10 min of incubation when positive results may be visible. The presence of the ThSMase transgene was verified by PCR (according to Lacorte et al, 2010), using the primer pair Sphingo973F (5′-TGGACAAGATGGGTTGGAGC-3′), and Sphingo1344R…”

Section: Screening Of Transgenic Events and Progeny Analysesmentioning

confidence: 99%

See 1 more Smart Citation

Expression of a sphingomyelinase‐coding gene from Trichoderma harzianum conferred bacterial tolerance in tobacco

Berbert

Vieira²,

Cabral

et al. 2022

Plant Pathology

View full text Add to dashboard Cite

Agriculture is one of the most important activities for the economic, social and technological development of society. However, plant diseases affect efforts to increase crop production and productivity, endangering economies and food security (Nelson, 2019). Diseases caused by bacteria are an important and widespread constraint, occurring in almost all crops, including vegetables, pulses, cereals, ornamentals, fruit and forages (Sundin et al., 2016). Bacterial diseases are difficult to identify and to control, and few pesticides are available for their effective management (Borkar & Yumlembam, 2017).Plant disease management employs several strategies involving chemical and biological control of pathogens; it may also involve the use of resistant or tolerant genotypes manipulated by both conventional and molecular breeding. Although several strategies

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Screening Of Transgenic Events and Progeny Analysesmentioning

confidence: 99%