Molecular characterization of carcinosarcomas arising in the uterus and ovaries

Brunetti, Marta; Agostini, Antonio; Staurseth, Julie; Davidson, Ben; Heim, Sverre; Micci, Francesca

doi:10.18632/oncotarget.26942

Cited by 11 publications

(10 citation statements)

References 49 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…On the basis of these findings, the authors concluded that the carcinomatous component seemed to be the more aggressive region of these tumors. Mutations in KRAS, the first signaling element of the RAS-RAF-MAPK pathway, have been detected in uterine carcinosarcoma in other studies but were not found in OCS or were only present at low frequencies 15,16,29 …”

Section: Molecular Profile Of Ovarian Carcinosarcomamentioning

confidence: 92%

Genomic and Molecular Characteristics of Ovarian Carcinosarcoma

Ramphal,

Hadfield,

Bandera

et al. 2023

American Journal of Clinical Oncology

View full text Add to dashboard Cite

Ovarian carcinosarcoma (OCS) is a rare malignancy with a poor prognosis. It is a biphasic tumor with malignant epithelial and mesenchymal components. A few mutations commonly seen in cancer have been identified in OCS, including TP53, PIK3CA, c-myc, ZNF217, ARID1A, and CTNNB1. Some OCS tumors have shown vascular endothelial growth factor positivity and limited HER2 expression. There is evidence of homologous recombination deficiency in OCS. This malignancy can be categorized as copy number high but has not been shown to have a high tumor mutational burden. There are mixed findings regarding the presence of biomarkers targeted by immune checkpoint inhibitors in OCS. For treatments other than systemic chemotherapy, the data available are largely based on in vitro and in vivo studies. In addition, there are case reports citing the use of poly-ADP ribose polymerase inhibitors, vascular endothelial growth factor inhibitors, and immunotherapy with varying degrees of success. This review paper will discuss the molecular and genomic characteristics of OCS, which can guide future treatment strategies.

show abstract

Section: Molecular Profile Of Ovarian Carcinosarcomamentioning

confidence: 92%

Genomic and Molecular Characteristics of Ovarian Carcinosarcoma

Ramphal,

Hadfield,

Bandera

et al. 2023

American Journal of Clinical Oncology

View full text Add to dashboard Cite

show abstract

“…Mutational analysis of TP53, PIK3CA, KRAS, HRAS , and NRAS was performed according to previously described protocols, using M13-linked PCR primers designed to flank and amplify targeted sequences ( 13 , 14 ). The primer combinations BRAF-F1 (5′TGCTTGCTCTGATAGGAAAATGAGATCT3′) and BRAF-R1 (5′ATCTCAGGGCCAAAAATTTAATCAGTG3′) were used to detect the mutation status of BRAF .…”

Section: Methodsmentioning

confidence: 99%

Mutation analysis and genomic imbalances of cells found in effusion fluids from patients with ovarian cancer

et al. 2020

Self Cite

View full text Add to dashboard Cite

Ovarian carcinomas and carcinosarcomas often cause malignant effusions, an accumulation within serous cavities of fluid containing cancer cells. Few studies have focused on the molecular alterations and genetic mechanisms behind effusion formation. The present study investigated the mutation status of TP53, PIK3CA, KRAS, HRAS, NRAS and BRAF in effusion fluids from 103 patients with ovarian cancer. In addition, array Comparative Genomic Hybridization (aCGH) analysis was performed on 20 effusions from patients with high-grade serous carcinoma (10 cases positive for TP53 mutation and 10 with TP53 wild-type). TP53 mutations, two of which were novel: c.826_830delCCTGT and c.475_476GC>TT, were identified in 44% of the cases. Mutations in KRAS, HRAS, and PIK3CA were identified in two, two and four cases, respectively. None of the effusions analysed showed NRAS or BRAF mutations. The aCGH analysis revealed highly imbalanced genomes similar to those described in primary ovarian carcinomas. No specific profile was indicated to distinguish tumors with TP53 mutations from those without. The molecular profiling of cells found in effusion fluids from patients with ovarian cancer thus showed considerable molecular heterogeneity. TP53 seems to be the most frequently mutated gene in these cells and may serve a leading role in the metastatic process.

show abstract

“…The mesenchymal component can resemble homologous histologic components commonly found in the uterus, or harbor heterologous components that are not normally native to the uterus, such as chondrosarcomatous or rhabdomyosarcomatous differentiation, and is by definition high-grade. The epithelial component is also high-grade and usually shows serous or endometrioid differentiation [ 98 ]. UCS shares mutational features similar to serous uterine carcinoma more frequently than endometrioid histologies, with extensive copy number alterations, and the majority harbor somatic TP53 mutations.…”

Section: Dysregulation Of Mirnas In Rare Gynecological Cancersmentioning

confidence: 99%

“…Brunetti et al performed molecular investigations on the expression status and mutations of the genes FHIT, HMGA1/2 , MTA1 and LIN28A ; the pseudogenes HMGA1P6 and HMGA1P7 ; and the miRNAs known to influence expression of these same genes in ovarian carcinosarcomas and UCS [ 98 ]. Mutations in KRAS, PIK3CA , and TP53 were identified in UCS with a frequency of 6%, 31%, and 75%, respectively.…”

Section: Dysregulation Of Mirnas In Rare Gynecological Cancersmentioning

confidence: 99%

“…Mutations in KRAS, PIK3CA , and TP53 were identified in UCS with a frequency of 6%, 31%, and 75%, respectively. In addition, an inverse correlation between downregulation of miRNAs such as miR16, miR26a, miR30c, miR214, let-7a and let-7d, and overexpression of HMGA1/2 , and MTA1 , were observed [ 98 ].…”

Section: Dysregulation Of Mirnas In Rare Gynecological Cancersmentioning

confidence: 99%

See 1 more Smart Citation

Could MicroRNAs Be Useful Tools to Improve the Diagnosis and Treatment of Rare Gynecological Cancers? A Brief Overview

Fiore

Suleiman

Pentimalli

et al. 2021

IJMS

View full text Add to dashboard Cite

Gynecological cancers pose an important public health issue, with a high incidence among women of all ages. Gynecological cancers such as malignant germ-cell tumors, sex-cord-stromal tumors, uterine sarcomas and carcinosarcomas, gestational trophoblastic neoplasia, vulvar carcinoma and melanoma of the female genital tract, are defined as rare with an annual incidence of <6 per 100,000 women. Rare gynecological cancers (RGCs) are associated with poor prognosis, and given the low incidence of each entity, there is the risk of delayed diagnosis due to clinical inexperience and limited therapeutic options. There has been a growing interest in the field of microRNAs (miRNAs), a class of small non-coding RNAs of ∼22 nucleotides in length, because of their potential to regulate diverse biological processes. miRNAs usually induce mRNA degradation and translational repression by interacting with the 3′ untranslated region (3′-UTR) of target mRNAs, as well as other regions and gene promoters, as well as activating translation or regulating transcription under certain conditions. Recent research has revealed the enormous promise of miRNAs for improving the diagnosis, therapy and prognosis of all major gynecological cancers. However, to date, only a few studies have been performed on RGCs. In this review, we summarize the data currently available regarding RGCs.

show abstract

Molecular characterization of carcinosarcomas arising in the uterus and ovaries

Cited by 11 publications

References 49 publications

Genomic and Molecular Characteristics of Ovarian Carcinosarcoma

Genomic and Molecular Characteristics of Ovarian Carcinosarcoma

Mutation analysis and genomic imbalances of cells found in effusion fluids from patients with ovarian cancer

Could MicroRNAs Be Useful Tools to Improve the Diagnosis and Treatment of Rare Gynecological Cancers? A Brief Overview

Contact Info

Product

Resources

About