Molecular characterization of African Swine fever viruses in Burkina Faso, Mali, and Senegal 1989–2016

Abstract

Summary African swine fever (ASF) has been endemic in sub‐Saharan Africa since the 1960s. Following its introduction in Senegal, in 1957, ASF steadily progressed through West Africa, reaching Burkina Faso in 2003, and later Mali in 2016. Despite the heavy burden of disease on pig production, little information is available on the genetic diversity of Africa swine fever virus (ASFV) in Burkina Faso, Mali and Senegal. Here, we used real‐time PCR ASFV to detect the ASFV genome in samples collected between 1989 and 2016, in Burkina Faso, Mali and Senegal, and conventional approaches for isolate characterization. The C‐terminal end of the p72 protein gene, the full E183L gene and the central variable region (CVR) within the B602L gene in ASFV genome were sequenced and compared to publicly available sequences. ASFV genome was found in 27 samples, 19 from Burkina Faso, three from Mali and five from Senegal. The phylogenetic analyses showed that all viruses belong to genotype I, with the ASFVs from Burkina Faso and Mali grouping with genotype Ia and ASFV serogroup 4, and those from Senegal with genotype Ib and the ASFV serogroup 1. The analysis of the CVR tetrameric tandem repeat sequences (TRS) showed four TRS variants in Burkina Faso, two in Senegal and one in Mali. The three countries did not share any common TRS, and all CVRs of this study differed from previously reported CVRs in West Africa, except for Senegal. Three of the five isolates from Senegal fully matched with the CVR, p72 and p54 sequences from ASFV IC96 collected during the 1996 ASF outbreak in Ivory Coast. This study shows the spread of the same ASFV strains across countries, highlighting the importance of continuous monitoring of ASFV isolates. It also calls for an urgent need to establish a regional plan for the control and eradication of ASF in West Africa.

One hundred years of African swine fever in Africa: Where have we been, where are we now, where are we going?

“…The outbreak of ASF in the port of San Pedro, Côte d'Ivoire in 2014 was caused by a genotype I virus most closely related to genotype I strains from Cameroon that differed at intra‐genotypic level from the 1996 Côte d'Ivoire strains (Couacy‐Hymann et al., 2019). The recent study of Minoungou and co‐workers (2021) confirmed the finding by Bastos and co‐workers (2003) that the 1996 epidemic in West Africa was not related to the endemic situation in Senegal and its neighbours, although a single variant isolated in Côte d'Ivoire in 1996 clustered with the Senegal group (Phologane et al., 2005).…”

Detection of African swine fever virus antibodies in serum using a pB602L protein-based indirect ELISA

“…Previous studies have shown that pB602L has good antigenicity and immunogenicity; the protein can be recognized by domestic pig and wild boar immune sera, and it may serve as a candidate antigen for the development of diagnostic methods for ASFV (28). Consistently high serological responses against pB602L were observed at time points later in infection than responses against the structural proteins in domestic pigs and bushpigs infected with a range of different viral isolates (29,30). B Gutiérrez-Castañeda et al show that ASFV B602L protein can be applied to antibody kinetics (17).…”

Porcine circovirus‐2 in Africa: Identification of continent‐specific clusters and evidence of independent viral introductions from Europe, North America and Asia

“…spleen, lung, liver, lymph nodes, kidney, trachea, heart, stomach, pancreas, whole blood and serum) collected from pigs in Burkina Faso ( n = 66), Cameroon ( n = 50), Cape Verde ( n = 28), Ethiopia ( n = 51), the Democratic Republic of the Congo ( n = 82), Mozambique ( n = 40), Nigeria ( n = 56), Senegal ( n = 12), Tanzania ( n = 15) and Zambia ( n = 8) (Table 1) were used in this study. The samples had been previously collected for confirmatory diagnosis of African Swine Fever (ASF) outbreaks or surveillance (passive and active) studies for ASF (Achenbach et al., 2017; Chang'a et al., 2019; Luka et al., 2017; Minoungou et al., 2021; Mulumba‐Mfumu et al., 2017; Wade et al., 2019). The DNA samples were screened for PCV‐2 by PCR using two primers P5 5′‐AGAAGCTCTTTATCGGAGGA‐3′ and P8 3′‐GTTCGTCCTTCCTCATTACC‐5′ which amplify a 687 bp segment covering the ORF2 of PCV‐2 (An et al., 2007).…”

“…Archived DNA (stored at −20 for ASF (Achenbach et al, 2017;Chang'a et al, 2019;Luka et al, 2017;Minoungou et al, 2021;Mulumba-Mfumu et al, 2017;Wade et al, 2019). The DNA samples were screened for PCV-2 by PCR using two primers P5 5′-AGAAGCTCTTTATCGGAGGA-3′ and P8 3′-GTTCGTCCTTCCTCATTACC-5′ which amplify a 687 bp segment covering the ORF2 of PCV-2 (An et al, 2007).…”