Molecular Characterization and Phenotypical Study ofβ-Thalassemia in Tucumán, Argentina

Abstract

The main hereditary hemoglobin (Hb) disorder in Argentina is β-thalassemia (β-thal). Molecular studies performed in the center of the country exhibited a marked prevalence of the codon 39 (C > T) and IVS-I-110 (G > A) mutations. The northwest region of Argentina has a different demographic history characterized by an important Spanish influx. Seventy-one β-thal carriers attending the Instituto de Bioquímica Aplicada, Tucumán, Argentina, were investigated for β-globin gene mutations by real-time polymerase chain reaction (RT-PCR). To examine the genotype-phenotype relationship, mean corpuscular volume (MCV), mean corpuscular Hb (MCH) and Hb A2 were measured. In order to recognize β-thal, Mentzer Index, Shine & Lal and Red Cell Distribution Width Index (RDWI), were calculated. The ethnic background of subjects revealed that 82.0% of the population was of Italian, Spanish and Arab origin. Seven mutations were detected: codon 39 (45.0%), IVS-I-1 (G > A) (22.5%), IVS-I-110 (16.3%), IVS-II-1 (G > A) (4.1%), IVS-I-1 (G > T) (2.0%), IVS-I-6 (T > C) (2.0%) and IVS-II-745 (G > C) (2.0%). In three families (6.1%), β-thal mutations were not determined. These results differed from other Argentinian studies because at present codon 39 and IVS-I-1 are the most prevalent; MCV, MCH and Hb A2 did not correlate with the type of mutation (β(0)/β(+)). Values of MCV (67.0 fL) and Hb A2 (4.85%) were unable to discriminate between them. Significant differences (p < 0.05) in MCV, MCH and Shine & Lal were observed between the undetermined group and the three most common mutations. These data show different patterns of β-thal mutations in the center and northwest regions of Argentina. Differences might represent the influence of Spanish immigration.

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

“…Most of the β‐thal mutations observed in our patients are of Mediterranean origin (10/21), including the four most common mutations (Cd 39 C>T, IVS1:1 G>A, IVS1:110 G>A, and δβ‐thal Spanish) (Table ), and this is consistent with the origins of Mexican mestizo population, which is mainly of Spaniard origin . The most frequent mutation, Cd 39 C>T (37.2%), is also the most common in Venezuela (34.1%), Brazil (36.8%), Cuba (30.5%), and Argentina (42.6%); this mutation has been observed all over the world …”

“…A similar mutation (‐90 C>T) was associated with an eightfold decreased transcription rate of the HBB gene . In the proximal CACCC sequence, there are at least nine different previously described mutations, of which only four have been observed in Latin American populations: ‐90 C>T has been observed in Jamaica with a frequency of 1.0%; ‐88 C>T in Venezuela (6.0%), Brazil (1.6%), and Cuba (2.4%); ‐87 C>T in Mexicans and Argentineans in 0.8% each; and ‐86 C>G in Venezuela (2.2%) …”

Human leucocyte antigen alloimmunisation in repeatedly transfused thalassemic Egyptian children and its relation to febrile non‐haemolytic transfusion reactions

“…Thus, the anaemia of β thalassemia results from a combination of ineffective erythropoiesis and peripheral haemolysis. β thalassemia is one of the most important genetic diseases associated with dependence on regular blood transfusion (Lazaerte et al , ).…”

Foxo3 gene expression and oxidative status in beta-thalassemia minor subjects

“…PCR and mutation detection by melting curve analysis were performed in a LightCycler system 2.0 (Roche Diagnostics), which can simultaneously measure signals emitted from two different fluorophores. PCR primers (forward: 5′-gctgtcatcacttagacctca-3′; reverse: 5′-cacagtgcagctcactcag-3′) were designed to amplify a 587-bp region of the β-globin gene surrounding the most common β-thalassemia mutations in the Argentinian population, as reported previously 12 . The clustering of many mutations within small distances permitted the use of two combinations of probes to analyze five common β-thalassemia mutations.…”