Molecular‐based identification and phylogeny of Armillaria species from Serbia and Montenegro

Abstract

Armillaria causes problems of root rot, kill trees and decay wood in the forests of Serbia and Montenegro, but the species involved have not hitherto been identified. The aim of this study was to identify field isolates collected on 25 localities. Identification was based on restriction fragment length polymorphism (RFLP) analysis of intergenic spacer 1 (IGS1) region and comparisons of IGS1 sequence with those available on NCBI database. Phylogenetic analysis was performed on sequence information from selected isolates to determine possible interrelationships between isolates with different banding patterns and previously identified tester isolates of five European Armillaria species. Five Armillaria species were identified in 90 isolates obtained from forests in Serbia and Montenegro. Armillaria gallica was most frequently isolated, followed by A. cepistipes, A. mellea, A. ostoyae and A. tabescens; two isolates remained unidentified. Restriction digestion of IGS1 amplification products with AluI produced 10 RFLP patterns. Patterns G4 (400, 250, 180) for A. gallica and pattern X (400, 180, 140) for isolates 74 and 79 are reported for the first time in European isolates. Eight RFLP patterns were observed after restriction with TaqI. Two patterns each were observed for A. ostoyae and A. gallica, and one each for A. cepistipes, A. mellea, A. tabescens and isolates 74 and 79. Parsimony analyses based on the IGS1 region placed the isolates into four clades: one including A. mellea, the second containing A. gallica-A. cepistipes isolates, while isolates of A. ostoyae and A. borealis were in the third clade. Armillaria tabescens differed from all annulate species. Phylogenetic analysis supported the conclusion that European Armillaria species are closely related and separated from a common ancestor in the near past. According to this survey five European Armillaria species are present in the forests of Serbia and Montenegro, while A. borealis is not present in the studied ecosystems.

Populations of Armillaria species in pine plantations in west-central Poland

“…However, a few A. solidipes isolates gave a new pattern with AluI. This, in diploid isolates of A. solidipes, seems to result from heterozygosity and the existence of variable multicopies in the rDNA array (Pérez-Sierra et al 1999;Kim et al 2000;Dunne et al 2002;Smith-White et al 2002;Lochman et al 2004a,b;Schnabel et al 2005;Keča et al 2006). Hybrid RFLP patterns of the IGS-1 rDNA region have also been discovered in other Armillaria species (Kim et al 2006;Antonin et al 2009).…”

“…DNA was extracted with the BeadBeat Micro Gravity (A&A Biotechnology, Gdynia, Poland) from 10 mg of powdered mycelium, according to the protocol provided. The ITS rDNA (between the 3' end of the SSU 18S rDNA and the 5' end of the LSU 28S) and IGS-1 rDNA (between the 3' end of the LSU 28S rDNA and the 5' end of the 5S gene) were amplified respectively with PCR primer pairs: ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3') and CNL12 (5' CTGAACGCCTCTAAGTCAG 3') and 5SA (5' CA-GAGTCCTATGGCCGTGGAT 3') (Matsushita and Suzuki 2005;Keča et al 2006). The translation elongation factor-1 alpha gene (EF-1 alpha gene) was amplified with primers EF595F (5' CGTGACTTCATC AAGAACATG 3') and EF1160R (5' CCGATCTTG-TAGACGTCCTG 3') (Maphosa et al 2006).…”

“…the internal transcribed spacer (ITS) and intergenic spacer (IGS) (Anderson and Stasovski 1992;Harrington and Wingfield 1995;Banik et al 1996;Terashima et al 1998a,b;Pérez-Sierra et al 1999;Fukuda et al 2003;Lochman et al 2004a;Matsushita and Suzuki 2005;Schnabel et al 2005;Keča et al 2006;Sekizaki et al 2008). More recently the translation elongation factor-1 alpha (EF-1 alpha) gene, which encodes an essential part of the protein translation machinery, was shown to have high phylogenetic utility and has been used in studies on fungi.…”

Identification protocol for sixArmillariaspecies from northeastern North America

“…for the purposes of species identification or clarification of the taxonomic relationships among newly identified species within a specific region or country (Bhutan: Coetzee et al 2005) as well as for broader taxo-nomic studies (Northern Hemisphere: Anderson and Stasovski 1992;Europe: Chillali et al 1998a, 1998b. Restriction fragment length polymorophism (RFLP) analysis of the IGS1 region has also become a widely used species identification technique and has been used in several national and regional surveys (British Columbia, Canada: White et al 1998;Europe: Chillali et al 1998a); North America: Kim et al 2000; Serbia and Montenegro: Keča et al 2006) as well as for identification of species associated with root disease on specific hosts (Pinus spp. in South Africa: Coetzee et al 2000).…”

“…Since Korhonen (1978), in Europe, and Anderson and Ullrich (1979), in North America, discovered that the causal fungus Armillaria mellea (Vahl:Fr.) Kummer sensu lato was actually a complex of biological species, numerous studies have investigated the geographic distribution, host range, and site relationships of the various species (Dumas 1988;Worrall 1992a, 1992b;Coetzee et al 2000;McLaughlin 2001) as well as the phylogeny of the genus (Anderson and Stasovski 1992;Piercey-Normore et al 1998;Terashima et al 1998;Keča et al 2006;Kim et al 2006).…”