Molecular analysis of the Von Hippel-Lindau (VHL) gene in a family with non-syndromic pheochromocytoma: the importance of genetic testing

Abstract

The two index patients of the family analyzed in this study had undergone bilateral adrenalectomy for pheochromocytomas. This prompted genetic analyses of the probands and seven first-degree relatives. The two pheochromocytoma patients and two additional asymptomatic family members were found to harbor a mutation c496G>T in exon 3 of the VHL gene. The family was then lost to systematic follow-up. Three years after performing the initial genetic evaluation, the sister of the probands, who was known to carry the same VHL germline mutation, was referred to our service after a pregnancy that was complicated by preeclampsia. She reported paroxysms suggestive for pheochromocytoma, but her urinary metanephrines were negative. However, computerized tomography of the abdomen showed an adrenal mass that was also positive on metaiodobenzylguanidine (MIBG) scintigraphy. This study illustrates that molecular analysis of the index patient(s) can lead to the identification of presymptomatic relatives carrying the mutation. Moreover, despite negative urinary metanephrines, the identification of a specific mutation has led to an increased suspicion and detection of a pheochromocytoma in the sister of the probands. Dois pacientes índices da família analisada neste estudo foram submetidos a adrenalectomia bilateral devido a feocromocitoma. Foi, então, realizado o estudo genético dos pacientes e de sete parentes de primeiro grau. Os dois pacientes com feocromocitoma e dois outros membros assintomáticos da família apresentaram a mutação c496G>T no exon 3 do gene VHL. A família perdeu seguimento médico. Três anos após a realização da avaliação genética, a irmã dos pacientes, portadora da mutação, foi encaminhada para o nosso serviço após uma gestação complicada por pré-eclampsia. Ela referia paroxismos sugestivos de feocromocitoma, mas as metanefrinas urinárias eram negativas. Entretanto, a tomografia computadorizada de abdômen evidenciou uma massa adrenal que também se contrastou na cintilografia com metaiodobenzilguanidina (MIBG). Esse estudo mostra que a análise molecular do paciente índice pode levar à identificação de parentes assintomáticos portadores da mutação. Além disso, mesmo com as metanefrinas urinárias negativas, a identificação de uma mutação específica levou a um aumento da suspeita e detecção de feocromocitoma na irmã dos afetados pela doença.

Mutation screening of VHL gene in a family with malignant bilateral pheochromocytoma: from isolated familial pheochromocytoma to von Hippel-Lindau disease

“…In previous studies of three generations of such a kindred and two separate families, a novel mutation was found in the VHL gene even though there were no other clinical manifestations of this disorder [15,25,26]. We suggest that long term follow up of such cases may reveal another manifestations of VHL as we experienced in this family.…”

“…Analysis of the VHL gene was performed using the protocol described by Cruz et al [15]. Exons 1, 2, and 3 of VHL gene were amplified by PCR with the following primers:…”

“…This gene encodes a protein that regulates hypoxia-induced proteins. Up to now, more than 300 germline VHL mutations have been known that cause loss of function of the VHL protein [15].…”

Familial Catecholamine-Secreting Tumors - Three Distinct Families with Hereditary Pheochromocytoma

“…The VHL tumor suppressor gene is located on chromosome 3p25-26. More than 300 germline VHL mutations have been identified that lead to loss of function of the VHL protein (Kim & Kaelin,2004;Cruz et al, 2007). Missense, nonsense and splice site mutations, microdeletions and microinsertions are detected in approximately two-thirds of the families.…”

“…For VHL gene mutation screening, analysis of VHL gene was performed using Cruz et al protocol (Hasani-Ranjbar et al, 2009;Cruz et al, 2007). Exons 1, 2, 3 of VHL gene was amplified by PCR with the following primers: 1F -5' CCATCCTCTACCGAGCGCGCG 3'; 1R -5' GGGCTTCAGACCGTGCTATCG2; 3 F -5' TGCCCAGCCACCGGTGTG 2; 3 R -5' GTCTATCCTGTACTTACCACAACA; 3F -5' CACACTGCCACATACATGCACTC 3'; 3R -5'ACTCATCAGTACCATCAAAAGCTG 3'.…”