Molecular Analysis of the Kirromycin Biosynthetic Gene Cluster Revealed β-Alanine as Precursor of the Pyridone Moiety

Abstract

Kirromycin is a complex linear polyketide that acts as a protein biosynthesis inhibitor by binding to the bacterial elongation factor Tu. The kirromycin biosynthetic gene cluster was isolated from the producer, Streptomyces collinus Tü 365, and confirmed by targeted disruption of essential biosynthesis genes. Kirromycin is synthesized by a large hybrid polyketide synthase (PKS)/nonribosomal peptide synthetase (NRPS) encoded by the genes kirAI-kirAVI. This complex involves some very unusual features, including the absence of internal acyltransferase (AT) domains in KirAI-KirAV, multiple split-ups of PKS modules on separate genes, and swapping in the domain organization. Interestingly, one PKS enzyme, KirAVI, contains internal AT domains. Based on in silico analysis, a route to pyridone formation involving PKS and NRPS steps was postulated. This hypothesis was experimentally proven by feeding studies with [U-13C3(15)N]beta-alanine and NMR and MS analyses of the isolated pure kirromycin.

The kirromycin gene cluster of Streptomyces collinus Tü 365 codes for an aspartate-α-decarboxylase, KirD, which is involved in the biosynthesis of the precursor β-alanine

“…7,8 The linear carbon skeleton of kirromycin is synthesized by a highly complex hybrid type I polyketide synthase (PKS)/non-ribosomal peptide synthetase machinery encoded by the genes kirAI-kirAVI and kirB. The hybrid PKS/non-ribosomal peptide synthetase thereby combines trans-AT PKS architecture represented in the enzymes KirAI-KirAV with cis-AT architecture in the PKS KirAVI.…”

“…Extender unit selection and loading are presumably carried out by two discrete acyltransferase enzymes, KirCI and KirCII, which are encoded in the gene cluster. 8 Sequence analysis of the kirromycin biosynthetic gene cluster led to the proposal that b-alanine might be a building block for the typical pyridone moiety of kirromycin. This hypothesis was confirmed by feeding studies.…”

“…Isotope-labeled b-alanine was efficiently incorporated at the expected positions in the kirromycin molecule. 8 b-Alanine is an important primary metabolite that is required for vitamin B 5 (pantothenate) biosynthesis. Pantothenate itself is a precursor of coenzyme A and phosphopantetheine, the prosthetic group of fatty acid or polyketide acyl carrier proteins and peptidyl carrier proteins of non-ribosomal peptide synthetases.…”

“…As double crossover frequency is very low in S. collinus, the chromosomal kirD gene was inactivated by insertional inactivation with plasmid pTL-Dl, a pA18 derivative 8 that contains a 265 bp internal fragment of kirD and an ermE*-promoter to avoid polar effects on downstream genes. Correct integration of the plasmid was confirmed by Southern hybridization (Supplementary Figure S1, Supplementary information).…”

“…To further investigate the function of KirD in kirromycin biosynthesis, the kirD gene was amplified by PCR using the primers KirDoe5¢ (cgcgcaagcttaggaggatttaaaatgtaccgagagatgctcaagtcg; HindIII site+ Shine Dalgarno sequence) and KirDoe3¢ (gcgctctagatcacgcgt cgacggtgtcgccgcg; XbaI site) from cosmid 1C24, 8 which carries the kirD region of the gene cluster, and cloned into pBlueskript II SK through the introduced restriction sites resulting in plasmid pTL-kirD1. Two b-alanine auxotrophic E. coli strains (E. coli SJ16 12 and E. coli DV9 13 ), which are mutated in panD and thus are unable to decarboxylate aspartate to b-alanine, were transformed with pTL-kirD1 or the empty vector, respectively.…”