Molecular analysis of tammar (Macropus eugenii) mammary epithelial cells stimulated with lipopolysaccharide and lipoteichoic acid

Daly, Kerry A.; Mailer, Sonia; Digby, Matthew R.; Lefèvre, Christophe; Thomson, Peter; Deane, Elizabeth M.; Nicholas, Kevin R.; Williamson, Peter

doi:10.1016/j.vetimm.2008.12.001

Cited by 22 publications

(19 citation statements)

References 69 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Microarray analysis of whole blood activated with LPS or heat-killed S. aureus showed stimulus-dependent patterns of cytokine appearance and leucocyte gene expression [5]. Another microarray study in tammar mammary epithelial cells showed that LTA induced lower levels of pro-inflammatory cytokines when compared with LPS [26]. Similarly, in a range of human and murine cells, LTA was consistently less potent than LPS in causing cytokine/chemokine release [27].…”

Section: Discussionmentioning

confidence: 99%

Differences in lipopolysaccharide- and lipoteichoic acid-induced cytokine/chemokine expression

et al. 2011

View full text Add to dashboard Cite

PurposeTo investigate differences in cytokine/chemokine release in response to lipoteichoic acid (LTA) or lipopolysaccharide (LPS) and contributing cellular mechanisms, in order to improve understanding of the pathogenesis of sepsis.MethodsLevels of cytokines/chemokines were measured in plasma and peritoneal lavage fluid of 10-week-old male mice (C57/B16) following intraperitoneal injection of LTA or LPS (250 µg), and in supernatants of murine J774.2 cells, immortalised blood monocytes, or isolated human monocytes treated with LTA or LPS (0–10 µg/ml). The role of cytokine/chemokine messenger RNA (mRNA) stability versus nuclear factor-kappaB (NF-κB) and activator protein-1 (AP-1) in mediating cytokine/chemokine release in J774 cells was also assessed.ResultsIn mice, plasma levels of keratinocyte-derived chemokine (KC), macrophage inflammatory protein (MIP)-2, interleukin (IL)-10, interferon (IFN)-γ and tumour necrosis factor-alpha (TNF-α) and peritoneal lavage fluid levels of KC, MIP-2 and TNF-α increased significantly 1 h after LPS. Only KC and MIP-2 levels increased 1 h after LTA. LPS-treated (10 μg/ml) J774 cells released MIP-2, IL-10, IFN-γ and TNF-α but not KC (24 h), whereas cells treated with 10 μg/ml LTA released only MIP-2. LPS-stimulated human monocytes released IL-10 and IL-8 (24 h); by contrast, LTA-treated cells released only IL-8. LPS and LTA activated NF-κB and AP-1 in J774 cells. The protein synthesis inhibitor cycloheximide abolished LPS-induced IL-10 mRNA expression and increased LTA- and LPS-induced mRNA for MIP-2 in J774 cells.ConclusionLTA and LPS, at clinically relevant concentrations, induced differential cytokine/chemokine release in vitro and in vivo, via effects distal to activation of NF-κB/AP-1 that might include chromatin remodelling or mRNA stability.Electronic supplementary materialThe online version of this article (doi:10.1007/s00134-011-2444-5) contains supplementary material, which is available to authorized users.

show abstract

Section: Discussionmentioning

confidence: 99%

Differences in lipopolysaccharide- and lipoteichoic acid-induced cytokine/chemokine expression

et al. 2011

View full text Add to dashboard Cite

show abstract

“…Although eight cathelicidin genes, MaeuCath1-8, have previously been reported in the wallaby (Daly et al, 2009), only MaeuCath1 has been investigated for its function in neonatal development. MaeuCath1 is expressed in the spleen, liver, skin, bone marrow, thymus, and gut of the PY (Daly et al, 2007;Lefèvre et al, 2007) and the adult mammary gland Khalil et al, 2008).…”

Section: Cathelicidins-domain-specific Delivery Of Bioactivitymentioning

confidence: 99%

The Comparative Genomics of Monotremes, Marsupials, and Pinnipeds: Models to Examine the Functions of Milk Proteins

et al. 2014

Self Cite

View full text Add to dashboard Cite

“…XM_003761554.2). Primers for 18S and 28S were obtained from Daly et al (2009), and RPL13A from Siddle et al (2013). Specific information for each primer is listed in Table 1. PCR amplification was performed using a Rotor Gene Q (Qiagen, Hilden, Germany) and the Rotor-Gene SYBR® Green PCR kit (Qiagen).…”

Section: Primers and Real-time Pcrmentioning

confidence: 99%

“…28S Ribosomal RNA Forward: CGATGTCGGCTCTTCCTATC Reverse: TCCTCAGCCAAGCACATACA* Daly et al (2009). *Reverse primer was modified according to marsupial sequences.…”

Section: Smentioning

confidence: 99%

See 1 more Smart Citation

Untitled

Supplemental Information 4: Melting Curves for 28S rRNA (28S)

View full text Add to dashboard Cite

Background: Reference genes serve an important role as an endogenous control/standard for data normalisation in gene expression studies. Although reference genes have recently been suggested for marsupials, independent analysis of reference genes on different immune tissues is yet to be tested. Therefore, an assessment of reference genes is needed for the selection of stable, expressed genes across different marsupial tissues. Methods: The study was conducted on red-tailed phascogales (Phascogale calura) using five juvenile and five adult males. The stability of five reference genes (glyceraldehyde-3-phosphate dehydrogenase, GAPDH; β-Actin, ACTB; 18S rRNA, 18S; 28S rRNA, 28S; and ribosomal protein L13A, RPL13A) was investigated using SYBR Green and analysed with the geNorm application available in qBase PLUS software. Results: Gene stability for juvenile and adult tissue samples combined show that GAPDH was most stable in liver and lung tissue, and 18S in small intestine and spleen. While all reference genes were suitable for small intestine and spleen tissues, all reference genes except 28S were stable for lung and only 18S and 28S were stable for liver tissue. Separating the two age groups, we found that two different reference genes were considered stable in juveniles (ACTB and GAPDH) and adults (18S and 28S), and RPL13A was not stable for juvenile small intestine tissue. Except for 28S, all reference genes were stable in juvenile and adult lungs, and all five reference genes were stable in spleen tissue. Discussion: Based on expression stability, ACTB and GAPDH are suitable for all tissues when studying the expression of marsupials in two age groups, except for adult liver tissues. The expression stability between juvenile and adult liver tissue was most unstable, as the stable reference genes for juveniles and adults were different. Juvenile and adult lung, small intestine and spleen share similar stable reference genes, except for small intestine tissues where all reference genes were stable in adults but RPL13A was not suitable in juveniles.

show abstract

Molecular analysis of tammar (Macropus eugenii) mammary epithelial cells stimulated with lipopolysaccharide and lipoteichoic acid

Cited by 22 publications

References 69 publications

Differences in lipopolysaccharide- and lipoteichoic acid-induced cytokine/chemokine expression

Differences in lipopolysaccharide- and lipoteichoic acid-induced cytokine/chemokine expression

The Comparative Genomics of Monotremes, Marsupials, and Pinnipeds: Models to Examine the Functions of Milk Proteins

Untitled

Contact Info

Product

Resources

About