Molecular Analysis of Fluoroquinolone-resistant<i>Salmonella</i>Paratyphi A Isolate, India

Nair, Satheesh; Unnikrishnan, Madhulika; Turner, A. Keith; Sc, Parija; Churcher, Carol; Wain, John; Harish, Belgode Narasimha

doi:10.3201/eid1203.050560

Cited by 17 publications

(7 citation statements)

References 12 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Mutations in gyrA outside of the QRDR were observed both in NAL R and NAL S isolates (data not shown). These data are in full agreement with the data of Nair et al [14] who demonstrated that a single gyrA mutation at Ser-83 alone resulted in resistance to nalidixic acid and reduced susceptibility to ciprofloxacin (MICs of 0.125-0.25 g/mL). Therefore, it was concluded that Ser-83 is an important site for determining fluoroquinolone resistance within S. Typhi and S. Paratyphi A isolates.…”

Section: Resultssupporting

confidence: 92%

Analysis of mechanisms involved in reduced susceptibility to ciprofloxacin in Salmonella enterica serotypes Typhi and Paratyphi A isolates from travellers to Southeast Asia

Hassing

Menezes

Pelt

et al. 2011

International Journal of Antimicrobial Agents

View full text Add to dashboard Cite

Owing to multidrug resistance, quinolones and third-generation cephalosporins are currently used as key antibiotics to combat Salmonella organisms. Therapy failure due to reduced ciprofloxacin susceptibility has been reported in endemic areas, but also in imported disease. Different bacterial resistance mechanisms may result in reduced ciprofloxacin susceptibility. In this study, the presence and expression of different resistance mechanisms resulting in reduced minimum inhibitory concentrations (MICs) for ciprofloxacin were evaluated in 23 blood-culture-derived Salmonella enterica serotypes Typhi and Paratyphi A organisms from ill-returned travellers to Asia. The presence of mutations in the quinolone resistance-determining region (QRDR) of the gyrA gene as well as an activated efflux pump and plasmid-mediated quinolone resistance genes was determined. Resistance selection during therapy and the clonal relatedness of all isolates were established. Efflux pump inhibition did not appear to affect the MICs of ciprofloxacin and activity of the efflux pump appeared to be specific for nalidixic acid. Repeated exposure of the isolates to ciprofloxacin did not result in a significant increase in the MICs for ciprofloxacin. Repetitive sequence-based polymerase chain reaction (rep-PCR) profiles identified five different genotypes, but no correlation with resistance was observed. However, a significant relation was found with geographic region; reduced ciprofloxacin susceptibility was only found in travellers returning from India and Pakistan. All isolates with reduced ciprofloxacin susceptibility had a mutation at position 83 in the QRDR region of the gyrA gene. Plasmid-mediated quinolone resistance was not found. These findings confirm that the reduced ciprofloxacin MIC in S. Typhi and S. Paratyphi A is solely due to an amino acid substitution in the QRDR 'cluster' of the gyrA gene.

show abstract

Section: Resultssupporting

confidence: 92%

Analysis of mechanisms involved in reduced susceptibility to ciprofloxacin in Salmonella enterica serotypes Typhi and Paratyphi A isolates from travellers to Southeast Asia

Hassing

Menezes

Pelt

et al. 2011

International Journal of Antimicrobial Agents

View full text Add to dashboard Cite

show abstract

“…Quinolone‐resistant Sal 4 isolates presented the parC (S80R) and gyrA (S83F, D87G) mutations that contributed to ciprofloxacin resistance, our findings were similar to those reported previously (Hopkins, Davies, & Threlfall, ; Nair et al, ). We have found five novel parC mutations including A628S, T255S, N395S, S469A, and A620T.…”

Section: Discussionsupporting

confidence: 91%

Alternate antimicrobial resistance genes in multidrug resistant Salmonella spp. isolated from retail meats in Vietnam using RNA‐sequencing analysis

Nghiêm

Nguyen

Jeung

et al. 2019

Journal of Food Safety

View full text Add to dashboard Cite

The aim of this study was to examine the resistome characteristics of Salmonella spp. Contamination found in raw retail beef, pork, and chicken samples collected in Hanoi, Vietnam. Approximately 28% (25/90) of samples tested carried Salmonella bacteria. A total of 13/25 (52%) of these Salmonella bacteria were resistant to at least one antibiotic and 9/25 (36%) of the isolates were found to be multidrug resistant. RNA‐seq analysis detected the expression of 107 antibiotic resistance genes (e.g., 22 β‐lactam, 46 aminoglycosides, 8 quinolones, 7 chloramphenicol, 6 tetracycline, and 6 sulfonamide‐trimethoprim resistance genes, and 12 other antimicrobial resistance genes). The parC (S80R and novel mutations A628S) and gyrA (S83F and D87G) mutations contributed to ciprofloxacin resistance in Salmonella Indiana. The findings illustrate the significant potential for multiple‐antibiotic resistant Salmonella in raw retail meats from Hanoi markets, and also provide abundant data to better understand the multidrug resistant Salmonella resistome. Practical Applications Studying the antibiotic resistance characteristics of Salmonella will provide important information for the prevention, control of diseases as well as food contamination control and regulations on the use of antibiotics in treatment and animal husbandry in order to limit antibiotic resistance of bacteria. Studying the expression genome of Salmonella, especially antibiotic resistance genes in multi‐antibiotic resistant Salmonella isolates, provides insight into the molecular epidemiology of antibiotic resistance genes. More importantly, it is possible to detect new mutations in antibiotic resistance genes that cause antibiotic resistance in Salmonella. In addition, studying the expression genome could help to identify new gene groups that can cause antibiotic resistance in this bacterium.

show abstract

“…The primers used to detect qnr plasmids (5) were: 5′-GGG TAT GGA TAT TAT TGA TAAG-3′ for qnr A and 5′-CTA ATC CGGG CAG CAC TAT TAT-3′ for qnr B and 5′- GTGAATTATTGCGGAATCCAGC for AAC1-F as described by Wang et al [22] and Nair et al [4]. PCR and sequencing using the aforementioned primers was performed according to Mammeri et al [23].…”

Section: Methodsmentioning

confidence: 99%

“…Recent literature cites isolated reports of high-level ciprofloxacin resistance in enteric fever, from India and elsewhere [13–18]. Studies on molecular analysis of fluoroquinolone resistance in clinical isolates of Salmonella enterica serotype Typhi and Paratyphi A from India are limited [2, 4, 13, 18].…”

Section: Introductionmentioning

confidence: 99%

Molecular analysis of high-level ciprofloxacin resistance in Salmonella enterica serovar Typhi and S. Paratyphi A: need to expand the QRDR region?

et al. 2008

View full text Add to dashboard Cite

Fourteen strains of S. Typhi (n=13) and S. Paratyphi A (n=1) resistant to ciprofloxacin were compared with 30 ciprofloxacin decreased-susceptibility strains on the basis of qnr plasmid analysis, and nucleotide substitutions at gyrA, gyrB, parC and parE. In ciprofloxacin-resistant strains, five S. Typhi and a single S. Paratyphi A showed triple mutations in gyrA (Ser83-->Phe, Asp87-->Asn, Glu133-->Gly) and a novel mutation outside the quinolone resistance determining region (QRDR) (Met52-->Leu). Novel mutations were also discovered in an isolate (minimum inhibitory concentration 8 microg/ml) in gyrA gene Asp76-->Asn and outside the QRDR Leu44-->Ile. Out of 30 isolates with reduced susceptibility, single mutation was found in 12 strains only. Genes encoding qnr plasmid (qnr A, qnr B, AAC1-F) were not detected in ciprofloxacin-resistant or decreased-susceptibility strains. Antimicrobial surveillance coupled with molecular analysis of fluoroquinolone resistance is warranted for reconfirming novel and established molecular patterns of resistance, which is quintessential for reappraisal of enteric fever therapeutics.

show abstract

Molecular Analysis of Fluoroquinolone-resistantSalmonellaParatyphi A Isolate, India

Cited by 17 publications

References 12 publications

Analysis of mechanisms involved in reduced susceptibility to ciprofloxacin in Salmonella enterica serotypes Typhi and Paratyphi A isolates from travellers to Southeast Asia

Analysis of mechanisms involved in reduced susceptibility to ciprofloxacin in Salmonella enterica serotypes Typhi and Paratyphi A isolates from travellers to Southeast Asia

Alternate antimicrobial resistance genes in multidrug resistant Salmonella spp. isolated from retail meats in Vietnam using RNA‐sequencing analysis

Molecular analysis of high-level ciprofloxacin resistance in Salmonella enterica serovar Typhi and S. Paratyphi A: need to expand the QRDR region?

Contact Info

Product

Resources

About