Molecular alterations resulting from frameshift mutations in peripheral myelin protein 22: Implications for neuropathy severity

Johnson, Jarrod S; Roux, Kyle J.; Fletcher, Bradley S.; Fortun, Jenny; Notterpek, Lucia

doi:10.1002/jnr.20691

Cited by 9 publications

(6 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Before transfection, rat Schwann cells were plated on poly-L-lysine-coated plates and maintained until reaching 70% confluence. Transient transfections with WT-PMP22-Myc plasmids (Johnson et al, 2005) and scrambled or pooled rat PMP22 shRNA plasmids containing GFP reporters (Applied Biological Materials) were performed using lipofectamine 3000 (Invitrogen) in Opti-MEM medium (Thermo Fisher Scientific) (Rao et al, 2015). The sequences (from 5Ј-3Ј) of PMP22 shRNA are as follows: 40 GCGGT GCTAGTGTTGCTCTTCGTCTCCAC; 161 ACTCCTCATCTGTGAG CGAATGGCTTCAG; 313 CTTGCTGGTCTGTGTGTGATGAGTGC AGC; and 438 CCTCCTTAGTGGCATCATCTACGTGATCC.…”

Section: Methodsmentioning

confidence: 99%

PMP22 Regulates Cholesterol Trafficking and ABCA1-Mediated Cholesterol Efflux

Zhou¹,

Miles

Tavori

et al. 2019

J. Neurosci.

View full text Add to dashboard Cite

The absence of functional peripheral myelin protein 22 (PMP22) is associated with shortened lifespan in rodents and severe peripheral nerve myelin abnormalities in several species including humans. Schwann cells and nerves from PMP22 knock-out (KO) mice show deranged cholesterol distribution and aberrant lipid raft morphology, supporting an unrecognized role for PMP22 in cellular lipid metabolism. To examine the mechanisms underlying these abnormalities, we studied Schwann cells and nerves from male and female PMP22 KO mice. Whole-cell current-clamp recordings in cultured Schwann cells revealed increased membrane capacitance and decreased membrane resistance in the absence of PMP22, which was consistent with a reduction in membrane cholesterol. Nerves from PMP22-deficient mice contained abnormal lipid droplets, with both mRNA and protein levels of apolipoprotein E (apoE) and ATPbinding cassette transporter A1 (ABCA1) being highly upregulated. Despite the upregulation of ABCA1 and apoE, the absence of PMP22 resulted in reduced localization of the transporter to the cell membrane and diminished secretion of apoE. The absence of PMP22 also impaired ABCA1-mediated cholesterol efflux capacity. In nerves from ABCA1 KO mice, the expression of PMP22 was significantly elevated and the subcellular processing of the overproduced protein was aberrant. In wild-type samples, double immunolabeling identified overlapping distribution of PMP22 and ABCA1 at the Schwann cell plasma membrane and the two proteins were coimmunoprecipitated from Schwann cell and nerve lysates. Together, these results reveal a novel role for PMP22 in regulating lipid metabolism and cholesterol trafficking through functional interaction with the cholesterol efflux regulatory protein ABCA1. Significance StatementUnderstanding the subcellular events that underlie abnormal myelin formation in hereditary neuropathies is critical for advancing therapy development. Peripheral myelin protein 22 (PMP22) is an essential peripheral myelin protein because its genetic abnormalities account for ϳ80% of hereditary neuropathies. Here, we demonstrate that in the absence of PMP22, the cellular and electrophysiological properties of the Schwann cells' plasma membrane are altered and cholesterol trafficking and lipid homeostasis are perturbed. The molecular mechanisms for these abnormalities involve a functional interplay among PMP22, cholesterol, apolipoprotein E, and the major cholesterol-efflux transporter protein ATP-binding cassette transporter A1 (ABCA1). These findings establish a critical role for PMP22 in the maintenance of cholesterol homeostasis in Schwann cells.

show abstract

Section: Methodsmentioning

confidence: 99%

PMP22 Regulates Cholesterol Trafficking and ABCA1-Mediated Cholesterol Efflux

Zhou¹,

Miles

Tavori

et al. 2019

J. Neurosci.

View full text Add to dashboard Cite

show abstract

“…To investigate the effects of Dicer shRNA on Schwann cell proliferation, equal numbers of infected cells (4 × 10 4 viable cells per well, n = 6) were maintained in culture for 24 hr prior to incubation with bromodeoxyuridine (BrdU; Roche BrdU labeling and detection kit; Roche, Nutley, NJ) as described elsewhere (Johnson et al, 2005). After 8 hr of BrdU incorporation, the cells were fixed, permeabilized, and processed according to the manufacturer's instructions.…”

Section: Methodsmentioning

confidence: 99%

Reduction of Dicer impairs Schwann cell differentiation and myelination

Verrier

Semple‐Rowland

Madorsky

et al. 2010

J of Neuroscience Research

View full text Add to dashboard Cite

The process of Schwann cell myelination requires precisely coordinated gene expression. At the onset of myelination, there is an increase in the expression of differentiation-promoting transcription factors that regulate key Schwann cell genes. Further control of myelin gene expression occurs at the posttranscriptional level and, in part, is mediated by RNA binding proteins and micro-RNAs (miRNAs). miRNAs are small, endogenously derived RNA molecules that repress gene expression by specifically binding to their mRNA targets. In the experiments described here, we tested whether miRNAs were essential in controlling myelination by reducing the levels of Dicer, an essential endoribonuclease in miRNA biogenesis. We decreased the expression of Dicer by about 60% within Schwann cells using a lentiviral vector expressing an shRNA against Dicer. The reduced levels of Dicer led to a decrease in the steady-state expression of selected miRNAs and of the transcription factors Oct6 and Egr2/Krox20, both of which are critical for Schwann cells differentiation and myelination. In contrast, the levels of c-jun and Sox2 were up-regulated by the reduction in Dicer and were associated with an increase in Schwann cell proliferation. In dorsal root ganglion cocultures, Schwann cells transduced with Dicer shRNA synthesized less myelin, which was accompanied by significant reductions in the levels of myelin basic protein and protein zero. These findings support a critical role for Dicer and miRNAs in Schwann cell differentiation and myelination.

show abstract

“…Previously characterized TrJ‐PMP22‐Myc3 plasmids (Tobler et al, 1999) were verified by sequencing. A plasmid that encodes the human WT‐PMP22 with a c‐Myc epitope in the second extracellular loop in the pLNCX2 vector (Johnson, Roux, Fletcher, Fortun, & Notterpek, 2005) was used as the template for construction of CARC‐ and/or CRAC‐PMP22 mutants. Amino acid (aa) substitutions were performed using a PCR‐based Quikchange Lightning Multi Site‐Directed Mutagenesis kit (Agilent Technologies), and the accuracy of each construct was verified by sequencing.…”

Section: Methodsmentioning

confidence: 99%

Subcellular diversion of cholesterol by gain‐ and loss‐of‐function mutations in PMP22

Zhou

Borchelt

Bauson

et al. 2020

Glia

View full text Add to dashboard Cite

Abnormalities of the peripheral myelin protein 22 (PMP22) gene, including duplication, deletion and point mutations are a major culprit in Type 1 Charcot–Marie–Tooth (CMT) diseases. The complete absence of PMP22 alters cholesterol metabolism in Schwann cells, which likely contributes to myelination deficits. Here, we examined the subcellular trafficking of cholesterol in distinct models of PMP22‐linked neuropathies. In Schwann cells from homozygous Trembler J (TrJ) mice carrying a Leu16Pro mutation, cholesterol was retained with TrJ‐PMP22 in the Golgi, alongside a corresponding reduction in its plasma membrane level. PMP22 overexpression, which models CMT1A caused by gene duplication, triggered cholesterol sequestration to lysosomes, and reduced ATP‐binding cassette transporter‐dependent cholesterol efflux. Conversely, lysosomal targeting of cholesterol by U18666A treatment increased wild type (WT)‐PMP22 levels in lysosomes. Mutagenesis of a cholesterol recognition motif, or CRAC domain, in human PMP22 lead to increased levels of PMP22 in the ER and Golgi compartments, along with higher cytosolic, and lower membrane‐associated cholesterol. Importantly, cholesterol trafficking defects observed in PMP22‐deficient Schwann cells were rescued by WT but not CRAC‐mutant‐PMP22. We also observed that myelination deficits in dorsal root ganglia explants from heterozygous PMP22‐deficient mice were improved by cholesterol supplementation. Collectively, these findings indicate that PMP22 is critical in cholesterol metabolism, and this mechanism is likely a contributing factor in PMP22‐linked hereditary neuropathies. Our results provide a basis for understanding how altered expression of PMP22 impacts cholesterol metabolism.

show abstract

Molecular alterations resulting from frameshift mutations in peripheral myelin protein 22: Implications for neuropathy severity

Cited by 9 publications

References 39 publications

PMP22 Regulates Cholesterol Trafficking and ABCA1-Mediated Cholesterol Efflux

PMP22 Regulates Cholesterol Trafficking and ABCA1-Mediated Cholesterol Efflux

Reduction of Dicer impairs Schwann cell differentiation and myelination

Subcellular diversion of cholesterol by gain‐ and loss‐of‐function mutations in PMP22

Contact Info

Product

Resources

About