Modulation of response to estrogens in cultured human female bone cells by a non-calcemic Vitamin D analog: changes in nuclear and membranal binding

Sömjen, Dalia; Katzburg, Sara; Sharon, Orli; Kaye, Alvin M.; Gayer, Batya; Kohen, Förtüne; Hendel, David; Posner, Gary H.

doi:10.1016/j.jsbmb.2004.03.005

Cited by 13 publications

(21 citation statements)

References 13 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Bone growth in diabetes which is disturbed [17,28] is also not enhanced to the same extent by hormone replacement therapy [26] and might be the result of lower hip BMD in young women due to their type 1 diabetes [27]; therefore the use of the specific phytoestrogens and their synthetic derivatives that we use in this study, might provide an alternative solution. Further studies in this direction in animal models have to be conducted for this purpose.…”

Section: Discussionmentioning

confidence: 99%

“…Subsequently, cells were incubated for 90min at 4°C with either of the steroid protein conjugates (estradiol 6-carboxymethyl-oxime; E 2 -6-CMO-ovalbumin [26][27][28][29], 10µM/well, E 2 -Ov conjugate labeled with Europium (1:1000, 200µl in binding medium) were then added and the incubation was continued for another 60 minutes at 4°C. Binding was terminated by four successive washes with ice-cold binding medium.…”

Section: Competitive Binding Assay For Membrane Estrogen Binding Actimentioning

confidence: 99%

“…RNA was extracted from cultured human bone cells, shown previously [28] to contain ERα and ERβ by western blot analysis [5], and subjected to reverse transcription as previously described [20]. For ERα, we used 5µl of cDNA in the reaction mixture with the primers 5' AATTCTGACAATCGACGCCAG 3' (forward) and 5' GTGCTTCAACATTCTCCCTCCTC 3' (reverse).…”

Section: Determination Of Mrna For Erα and Er By Real Time Pcrmentioning

confidence: 99%

See 2 more Smart Citations

Phytoestrogenic Compounds and Their Synthetic Analogs, Contrary to Estradiol- 17b Stimulates Human Derived Female Cultured Bone Cells in Hyperglycemic Conditions

Sömjen¹,

Katzburg²,

Tamir³

et al. 2011

J Steroids Hormon Sci

View full text Add to dashboard Cite

Cultured female-derived human osteoblasts (hObs) responded by different parameters to the phytoestrogens: daidzein (D), glabrene (Gla) and glabridin (Glb), to their synthetic derivatives; carboxy-daidzein (cD) and to estradiol-17β (E 2 ). Since the skeletal protective effects of estrogens are not discernible in diabetic women, we tested the effects of these compounds on hObs grown in growth medium with high glucose (HG; 9.0g/L; 44mM) compared to normal glucose (NG; 4.5g/L; 22mM) using the stimulation of creatine kinase specific activity (CK) and 3 [H] thymidine incorporation into DNA (DNA) as hormonal responsiveness markers. HG slightly increased DNA and CK in hObs.Stimulations by E 2 was abolished and by cD and D was slightly decreased in HG, but not by Gla and Glb in both age groups. Growing hObs in HG upregulated the expression of mRNA of both ER and ERβ in cells from pre-but not from post-menopausal women. Cells from both age groups express also mRNA for 25 hydroxy vitamin D 3 1-α hydroxylase and showed enzymic activity which were down-regulated by HG in both age groups. Whether Gla and Glb act differentially via ERs and/or 1-α hydroxylase is not yet established.Since these compounds are active even in HG, they might be used for treating hyperglycemic/diabetic women. Journal of Steroids & Hormonal Science Materials and Methods ReagentsAll reagents used were analytical grade. Estradiol-17β (E 2 ), daidzein (D) and the creatine kinase (CK) assay kit were purchased from Sigma Chemicals Co. (St. Louis, MO). Carboxy-D (cD) was synthesized by us [20], licorice products: Gla and Glb were produced by us [19]. Cell culturesHuman bones were obtained from biopsies of patients undergoing corrective surgery following accidental injury, hip or knee replacement. All patients (women and men) were healthy, non-osteoporotic and not receiving hormonal replacement treatment. Three groups were defined: Pre-menopausal women, ranging between 37-55 years old, (n=5). Post-menopausal women, ranging between 60-84 years old, (n=5). The non-enzymic method for isolation and culture of human bone cells and their characterization as osteoblasts was described previously [12]. Briefly, samples of the trabecular surface of the iliac crest or long bones were cut into 1mm 3 pieces and extensively and repeatedly washed with phosphate buffered saline (PBS) to remove blood components. The explants, with no enzymatic digestion, were seeded in 100mm diameter tissue culture dishes and incubated in DMEM medium without Ca ++ (to avoid fibroblastic growth [12], containing 10% fetal calf serum (FCS) and antibiotics. Cell outgrowth from the bone explants was apparent after 6-10 days. First passage cells were seeded at a density of 3x10 5 cells per 35mm tissue culture dish in phenol red free DMEM with 10% charcoal stripped FCS and incubated at 37°C in 5% CO 2 . To obtain "high glucose" (HG) conditions, the medium including the FCS, was supplemented with glucose up to a final concentration of 44nM (9.0gm/ liter). Glucose concentration in the regula...

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Competitive Binding Assay For Membrane Estrogen Binding Actimentioning

confidence: 99%

Section: Determination Of Mrna For Erα and Er By Real Time Pcrmentioning

confidence: 99%

See 1 more Smart Citation

Phytoestrogenic Compounds and Their Synthetic Analogs, Contrary to Estradiol- 17b Stimulates Human Derived Female Cultured Bone Cells in Hyperglycemic Conditions

Sömjen¹,

Katzburg²,

Tamir³

et al. 2011

J Steroids Hormon Sci

View full text Add to dashboard Cite

show abstract

“…Cell cultures: (a) Primary human bone cells (Obs) from females or males were prepared by us [9]. (b) Human bone cell lines: SaOS2-and hFOB-human bone cell lines were obtained from ATCC (Manassas, VA, USA).…”

Section: Methodsmentioning

confidence: 99%

“…Adequate availability of vitamin D 3 and its active metabolite, 1,25 is essential for skeletal health and modulation of cell growth and differentiation of both Obs and osteoclasts [4], but it is hypercalcemic [4,5] and therefore optimal bone growth and prevention of osteoporosis which requires its adequate concentrations [6,7] needs the use of its less-calcemic analogs having no adverse calcemic activity. We tested structurally modified less-calcemic analogs for their activity and found that JKF1624F 2 -2(JKF) and QW1624F 2 -2(QW) [8,9] stimulated Obs [8,9] and pre-treatment with them up-regulated both responsiveness and sensitivity to estrogens [8][9][10]. In the present study we analyzed the expression and regulation of LOs as well as ROS formation by these analogs.…”

Section: Introductionmentioning

confidence: 92%

Vitamin D analogs induce lipoxygenase mRNA expression and activity as well as reactive oxygen species (ROS) production in human bone cells

Sömjen

Katzburg

Knoll

et al. 2010

The Journal of Steroid Biochemistry and Molecular Biology

View full text Add to dashboard Cite

The role of non-calcemic analogs of vitamin D in differentiation of cultured rat bone marrow into osteoblast-like cells: Age and sex differences

Sömjen

Kaye

Ofer

et al. 2005

J Endocrinol Invest

View full text Add to dashboard Cite

We have previously demonstrated that rat bone in vivo and rat bone cells in vitro, responded sex-specifically to gonadal steroids in stimulation of the specific activity of the BB isozyme of creatine kinase (CK), a marker for hormonal responsiveness. Pre-treatment with vitamin D analogs up-regulated the sex-specific responsiveness and sensitivity to gonadal steroids. We also found that mice cultured femoral bone marrow (BM) in the presence of dexamethasone (DEX) and 1,25(OH)2D3 (1,25D) or both differentiated into osteoblast-like cells (Obs), which acquired sex-specific responsiveness to gonadal steroids. This response was significantly augmented in the presence of both agents. In the present study, we examined the effect of age, sex and vitamin D non-hypercalcemic analogs on the differentiation of rat derived femoral BM into Obs. In female or male derived BM from intact but not gonadectomized rats DEX and DEX+1,25D increased the constitutive levels of CK. BM derived from old females showed lower stimulation of CK than BM originated from young females by estradiol (E2) or raloxifene (Ral) in the presence of both DEX and 1,25D. The non-hypercalcemic analogs of vitamin D: CB 1093 (CB), EB 1089 (EB) and MC 1288 (MC) were more effective than 1,25D in both age groups in stimulating CK in the absence of DEX. In the presence of DEX, there was a further increase in CK with the same differential effectiveness. BM from gonadectomized male or female rats lost the sex-specific response, responding to both E2 and dihydrotestosterone (DHT). BM derived from both intact and gonadectomized males and females, growing with DEX or DEX+1,25D showed increased specific activity of constitutive levels of alkaline phodphatase (AP). No significant stimulation of AP was seen in any BM by gonadal steroids. These findings suggest that manipulation of the hormonal milieu in early stages of differentiation sequence of Obs determines the subsequent selective responsiveness of the developing bone tissue to sex steroids. Also non-calcemic vitamin D analogs were more effective in this process than 1,25D and showed activity even in the absence of DEX and may be applied to the differentiation process for bone tissue engineering.

show abstract

Modulation of response to estrogens in cultured human female bone cells by a non-calcemic Vitamin D analog: changes in nuclear and membranal binding

Cited by 13 publications

References 13 publications

Phytoestrogenic Compounds and Their Synthetic Analogs, Contrary to Estradiol- 17b Stimulates Human Derived Female Cultured Bone Cells in Hyperglycemic Conditions

Phytoestrogenic Compounds and Their Synthetic Analogs, Contrary to Estradiol- 17b Stimulates Human Derived Female Cultured Bone Cells in Hyperglycemic Conditions

Vitamin D analogs induce lipoxygenase mRNA expression and activity as well as reactive oxygen species (ROS) production in human bone cells

The role of non-calcemic analogs of vitamin D in differentiation of cultured rat bone marrow into osteoblast-like cells: Age and sex differences

Contact Info

Product

Resources

About