Modulation of Cytokines and Extracellular Matrix Proteins Expression by Leishmania amazonensis in Susceptible and Resistant Mice

Abstract

Leishmaniases are a complex of diseases with a broad spectrum of clinical forms, which depend on the parasite species, immunological status, and genetic background of the host. In the Leishmania major model, susceptibility is associated with the Th2 pattern of cytokines production, while resistance is associated with Th1 response. However, the same dichotomy does not occur in L. amazonensis -infected mice. Cytokines are key players in these diseases progression, while the extracellular matrix (ECM) components participate in the process of parasite invasion as well as lesion healing. In this article, we analyzed the influence of host genetics on the expression of cytokines, inducible nitric oxide synthase (iNOS), and ECM proteins, as well as the parasite load in mice with different genetic backgrounds infected by L. amazonensis . C57BL/10 and C3H/He mice were subcutaneously infected with 10 6 L. amazonensis promastigotes. Lesion kinetics, parasite load, cytokines, iNOS, and ECM proteins expression were measured by quantitative PCR (qPCR) in the footpad, draining lymph nodes, liver, and spleen at early (24 h and 30 days) and late phase (120 and 180 days) of infection. Analysis of lesion kinetics showed that C57BL/10 mice developed ulcerative lesions at the inoculation site after L. amazonensis infection, while C3H/He showed slight swelling in the footpad 180 days after infection. C57BL/10 showed progressive enhancement of parasite load in all analyzed organs, while C3H/He mice showed extremely low parasite loads. Susceptible C57BL/10 mice showed high levels of TGF-β mRNA in the footpad early in infection and high levels of proinflammatory cytokines mRNA (IL-12, TNF-α, and IFN-γ) and iNOS in the late phase of the infection. There is an association between increased expression of fibronectin, laminin, collagen III and IV, and TGF-β. On the other hand, resistant C3H/He mice presented a lower repertory of cytokines mRNA expression when compared with susceptible C57BL/10 mice, basically producing TNF-α, collagen IV, and laminin early in infection. The findings of our study indicate that L. amazonensis infection induces different cytokine expression in resistant and susceptible mice but not like the L. major model. An organ-compartmentalized cytokine response was observed in our model. Host genetics determine this response, which modulates ECM proteins expression.

Sex-Biased Control of Inflammation and Metabolism by a Mitochondrial Nod-Like Receptor

“…In addition to cellular and lipid metabolism, infection with Leishmania may lead to modifications of the extracellular matrix (ECM) and collagen composition of the dermis at the site of infection ( 70 , 100 ). In addition, cutaneous leishmaniasis is also characterized by vascular remodeling and lymphangiogenesis mediated by the vascular endothelial growth factor A (VEGF-A)/VEGF receptor 2 (VEGFR-2) signaling pathway that is essential for lesion resolution ( 71 , 101 , 102 ).…”

Nitric Oxide Induction in Peritoneal Macrophages by a 1,2,3-Triazole Derivative Improves Its Efficacy upon Leishmania amazonensis In Vitro Infection

“…It is known that L. amazonensis infection modulates an organ-compartmentalized cytokine response in susceptible and resistant mice, and Leishmania parasite elimination is accomplished with a robust pro-inflammatory response, accompanied by the release of host-protective cytokines . The upregulation of cytokines that play a part in the inflammatory response in leishmaniasis observed in BALB/c peritoneal macrophages infected or not with L.…”

“…Besides inducing iNOS mRNA expression, compound 4 also upregulated the expression of the pro-inflammatory cytokines TNF-α, IL-1β, IL-6, and IL-12 as well as the regulatory cytokine IL-10. It is known that L. amazonensis infection modulates an organ-compartmentalized cytokine response in susceptible and resistant mice, 50 and Leishmania parasite elimination is accomplished with a robust pro-inflammatory response, accompanied by the release of host-protective cytokines. 51 The upregulation of cytokines that play a part in the inflammatory response in leishmaniasis observed in BALB/c peritoneal macrophages infected or not with L. amazonensis highlighted the in vitro immunomodulatory activity of compound 4 and its potential to enhance the immune response against Leishmania infection.…”

“…Data are expressed as mean ± standard deviation (SD) in tables or plotted in graphs. The IC50 and CC 50 values were calculated from the nonlinear regression curve fit of the log of the inhibitor concentration versus the normalized response of parasites or cell viability. The standard curve linear regression fit of NaNO 2 was obtained from a known concentration of the standard curve versus absorbance values using a standard curve linear regression fit with R 2 > 0.99.Differences between groups were analyzed by the Kruskal−Wallis test, followed by multiple comparison Dunn's test, or by the Mann− Whitney test, considering a significance level of 5%.…”

Amentoflavone as an Ally in the Treatment of Cutaneous Leishmaniasis: Analysis of Its Antioxidant/Prooxidant Mechanisms

“…Then, qPCR was performed on QuantStudio 3 equipment (Applied Biosystems). The sequences of the specific primers targeting mouse genes were Nfe2l2 - nuclear factor, erythroid derived 2, like 2, transcript variant 1 (Nrf2) (forward 5’TCACACGAGATGAGCTTAGGGCAA3’, reverse 5’TACAGTTCTGGGCGGCGACTTTAT3’), Hmox1 - heme oxygenase 1 (HO-1) (forward 5’CCCAAAACTGGCCTGTAAAA 3’, reverse 5’CGTGGTCAGTCAACATGGAT3’), L-ferritin (forward 5’TTCCAGGATGTGCAGAAGCC3’, reverse 5’AAGAGGGCCTGATTCAGGTTC3’) and Actb - actin, beta (β-actin) (forward 5’AGCTGCGTTTTACACCCTTT3’, reverse 5’AAGCCATGCCAATGTTGTCT3’) ( Tomiotto-Pellissier et al., 2018 ), as well as Nos2 - nitric oxide synthase 2 , inducible, transcript variant 1 (iNOS) (foward 5’GGATCTTCCCAGGCAACCA3’, reverse 5’CAATCCACAACTCGCTCCAA3’) and Rplp0 - ribosomal protein, large, P0 (Rplp0) (foward 5’GCCAGCTCAGAACACTGGTCTA3’, reverse 5’ATGCCCAAAGCCTGGAAGA3’) ( Cardoso et al., 2020 ). The reaction mixtures contained 10 µl of GoTaq ® qPCR Master Mix (Promega), 20 ng of cDNA for Nrf2, HO-1 and β-actina targets, and 100 ng of cDNA for Rplp0 and iNOS targets; 100 nM of Nrf2, HO-1, ferritin and β-actin primers, 600 nM of iNOS primer and 900 nM of Rplp0 primer in a final volume of 20 µl.…”