Modeling early stages of endoderm development in epiblast stem cell aggregates with supply of extracellular matrices

Abstract

Endoderm precursors expressing FoxA2 and Sox17 develop from the epiblast through the gastrulation process. In this study, we developed an experimental system to model the endoderm-generating gastrulation process using epiblast stem cells (EpiSCs). To this end, we established an EpiSC line i22, in which enhanced green fluorescent protein is coexpressed with Foxa2. Culturing i22 EpiSCs as aggregates for a few days was sufficient to initiate Foxa2 expression, and further culturing of the aggregates in Matrigel promoted the sequential activation of transcription factor genes involved in endoderm precursor development, e.g., Eomes, Gsc, and Sox17. In aggregation culture of i22 cells for 3 days, all cells expressed POU5F1, SOX2, and E-cadherin, a signature of the epiblast, whereas expression of GATA4 and SOX17 was also activated moderately in dispersed cells, suggesting priming of these cells to endodermal development. Embedding the aggregates in Matrigel for further 3 days elicited migration of the cells into the lumen of laminin-rich matrices covering the aggregates, in which FOXA2 and SOX17 were expressed at a high level with the concomitant loss of E-cadherin, indicating the migratory phase of endodermal precursors. Prolonged culturing of the aggregates generated three segregating cell populations found in post-gastrulation stage embryos: (1) definitive endoderm co-expressing high SOX17, GATA4, and E-cadherin, (2) mesodermal cells expressing a low level of GATA4 and lacking E-cadherin, and (3) primed epiblast cells expressing POU5F1, SOX2 without E-cadherin. Thus, aggregation of EpiSCs followed by embedding of aggregates in the laminin-rich matrix models the gastrulation-dependent endoderm precursor development. K E Y W O R D S endoderm, epiblast stem cells, extracellular matrix, FOXA2, gastrulation

Matrigel inhibits elongation and drives endoderm differentiation in aggregates of mouse embryonic stem cells

“…However, evidence suggests that laminin, a major component of Matrigel, can direct human ES cells toward the endoderm lineage [42]. Furthermore, studies have demonstrated that culturing EPI stem cells in Matrigel results in up-regulated levels of endoderm-related transcription factors such as Sox17 [43], further supporting the notion that Matrigel influences lineage commitment towards endoderm.…”

Wnt signal-dependent antero-posterior specification of early-stage CNS primordia modeled in EpiSC-derived neural stem cells

“…or Nacalai) was used to dissociate cells except for the KN3 line, where the cell sheets were mechanically dissociated into cell clumps (Table 1). RNA was extracted from the cultures as described in Inamori et al (2020). To differentiate the NSCs into neurons or glial cells, the dissociated cells were plated on uncoated dishes and cultured in basic culture medium for 3 days for neuronal development, or in medium containing 1% fetal bovine serum for 5 days for glial cell development.…”

“…Principal component analysis of the data was performed using Subio software (Subio Inc., Amami, Japan). RT-qPCR analysis of individual mRNA levels was performed as described in Inamori et al (2020) using the primers described by Iwafuchi-Doi et al (2012), except for Hoxb6 (Forward, TTCCTATTTCGTGAACTCCACCTT; Reverse, CCG CATAGCCAGACGAGTAGA) and Hoxa7 (Forward, ACGCGC TTTTTAGCAAATATACG; Reverse, GGGTGCAAAGGAGCA AGAAG) (Dickson et al, 2009).…”

“…The N2 enhancer is activated by the combined action of Otx2, Zic2/3, and Pou3/5 transcription factors (TFs) (Iwafuchi-Doi et al, 2012). Because the Zic2/3 (Elms et al, 2004;Iida et al, 2020) and Pou3/5 genes (Lavial et al, 2007;Iwafuchi-Doi et al, 2012) are more widely expressed than Otx2 (Chapman et al, 2002;Iwafuchi-Doi et al, 2012) in both mouse and chicken embryos, the activity distribution of the N2 enhancer reflects Otx2 expression. The mouse N2 enhancer sequence was regulated correctly in the chicken and zebrafish embryos concerning the spatial distribution of the enhancer activity in the anterior epiblast, neural plate, and nascent neural tubes (Iwafuchi-Doi et al, 2011).…”

Corrigendum

“…In Inamori et al (2020), the repository source of the mice was missing in the Acknowledgment Section.…”