MN/CA IX/G250 as a potential target for immunotherapy of renal cell carcinomas

Uemura, Hirotsugu; Nakagawa, Yasuaki; Yoshida, Koichi; Saga, Shinsuke; Yoshikawa, Kazuhiro; Hirao, Yoshihiko; Oosterwijk, Egbert

doi:10.1038/sj.bjc.6690757

Cited by 134 publications

(80 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…CA9 is a known antigen currently being targeted for RCC immunotherapy (Divgi et al, 1998;Steffens et al, 1999;Uemura et al, 1999;Grabmaier et al, 2000;Li et al, 2001;Bui et al, 2003;Kennett, 2003). To compare expression of CD70 with CA9, we performed real-time quantitative RT -PCR analysis on multiple normal tissues and clinical RCC samples (Figure 7).…”

Section: Cd70 Exhibits a More Restricted Normal Tissue Distribution Amentioning

confidence: 99%

“…Antibodies can also be used to specifically deliver cytotoxic drugs to tumour cells as immunoconjugates that bind to, and internalise with, highly expressed cell surface antigens. An example of an antigen found to be overexpressed in RCC is carbonic anhydrase IX (CA9), which is the target for the monoclonal antibody (mAb) G250 (Pastorek et al, 1994;Uemura et al, 1999;Grabmaier et al, 2000;Li et al, 2001;Bui et al, 2003). Immunoscintigraphy of RCC patients dosed with iodine-131-labelled G250 demonstrated tumour targeting to metastatic sites (Divgi et al, 1998;Steffens et al, 1999;Kennett, 2003).…”

mentioning

confidence: 99%

See 1 more Smart Citation

CD70 (TNFSF7) is expressed at high prevalence in renal cell carcinomas and is rapidly internalised on antibody binding

Pj¹,

Ja²,

Steers

et al. 2006

Br J Cancer

View full text Add to dashboard Cite

In order to identify potential markers of renal cancer, the plasma membrane protein content of renal cell carcinoma (RCC)-derived cell lines was annotated using a proteomics process. One unusual protein identified at high levels in A498 and 786-O cells was CD70 (TNFSF7), a type II transmembrane receptor normally expressed on a subset of B, T and NK cells, where it plays a costimulatory role in immune cell activation. Immunohistochemical analysis of CD70 expression in multiple carcinoma types demonstrated strong CD70 staining in RCC tissues. Metastatic tissues from eight of 11 patients with clear cell RCC were positive for CD70 expression. Immunocytochemical analysis demonstrated that binding of an anti-CD70 antibody to CD70 endogenously expressed on the surface of A498 and 786-O cell lines resulted in the rapid internalisation of the antibody -receptor complex. Coincubation of the internalising anti-CD70 antibody with a saporin-conjugated secondary antibody before addition to A498 cells resulted in 50% cell killing. These data indicate that CD70 represents a potential target antigen for toxin-conjugated therapeutic antibody treatment of RCC.

show abstract

Section: Cd70 Exhibits a More Restricted Normal Tissue Distribution Amentioning

confidence: 99%

mentioning

confidence: 99%

CD70 (TNFSF7) is expressed at high prevalence in renal cell carcinomas and is rapidly internalised on antibody binding

Pj¹,

Ja²,

Steers

et al. 2006

Br J Cancer

View full text Add to dashboard Cite

show abstract

“…MN expression in clear cell RCC (ccRCC) (Oosterwijk et al, 1986;Uemura et al, 1999), suggesting that critical elements promoting G250 expression are constitutively present/active in this tumor.…”

Section: G250mentioning

confidence: 99%

Strict regulation of CAIXG250/MN by HIF-1α in clear cell renal cell carcinoma

Grabmaier¹,

Weijert²,

Verhaegh³

et al. 2004

Oncogene

164

118

View full text Add to dashboard Cite

Renal cell carcinoma of the clear cell type (ccRCC) is associated with loss of functional von Hippel-Lindau (VHL) protein and high, homogeneous expression of the G250 MN protein, an isoenzyme of the carbonic anhydrase family. High expression of G250MN is found in all ccRCCs, but not in most normal tissues, including normal human kidney. We specifically studied the mechanism of transcriptional regulation of the CAIX G250 gene in RCC. Previous studies identified Sp1 and hypoxia-inducible factor (HIF) as main regulatory transcription factors of G250 MN in various non-RCC backgrounds. However, G250MN regulation in RCC has not been studied and may be differently regulated in view of the HIF accumulation under normoxic conditions due to VHL mutations. Transient transfection of different G250 MN promoter constructs revealed strong promoter activity in G250 MN -positive RCC cell lines, but no activity in G250 MN -negative cell lines. DNase-I footprint and bandshift analysis demonstrated that Sp1 and HIF-1a proteins in nuclear extracts of RCC cells bind to the CAIX promoter and mutations in the most proximal Sp1 binding element or HIF binding element completely abolished CAIX promoter activity, indicating their critical importance for the activation of G250 expression in RCC. A close correlation between HIF-1a expression and G250 MN expression was observed. In contrast, no relationship between HIF-2a expression and G250 MN was seen. The participation of cofactor CBP/p300 in the regulation of G250 transcription was shown. In conclusion, HIF-1a and Sp1, in combination with CBP/p300, are crucial elements for G250 MN expression in ccRCC, and CAIX G250 can be regarded as a unique HIF-1a target gene in ccRCC.

show abstract

“…Specific oligonucleotide primers were designed on the basis of previously published data: outer sense ACTGCTGCTTCTGATGCCTGT, outer antisense AAAGGCGGTGCTGAGGT, nested sense GGGACAAAGAAG-GGGATGAC and nested antisense AGTTCTGGGAGCGGC-GGGA. 11,34 PCR was performed in a Perkin-Elmer (Foster City, CA) thermocycler (GeneAmp PCR system 240) using Taq polymerase in a 25 ll mix containing PCR buffer with (NH 4 ) 2 SO 4 (MBI Fermentas, Vilnius, Lithuania) and 10 pmol of each primer. Conditions for the first round of PCR were as follows: 35 cycles at 94°C for 1 min, 57°C for 2 min and 72°C for 1 min.…”

Section: Rt-pcrmentioning

confidence: 99%

Detection of carbonic anhydrase 9–expressing tumor cells in the lymph nodes of vulvar carcinoma patients by RT‐PCR

Kowalewska

Radziszewski

Kulik

et al. 2005

Intl Journal of Cancer

View full text Add to dashboard Cite

Regional lymph node status is an important prognostic factor for vulvar cancer. The goal of our study was to elaborate a reliable test for detecting micrometastases, undetectable by traditional methods, in the lymph nodes of vulvar squamous carcinoma patients. For this purpose, carbonic anhydrase-9 (CA9) was investigated as a cancer-related marker by RT-PCR. Firstly, primary carcinoma specimens were examined for CA9 expression by immunohistochemistry with M75 monoclonal antibody. All 19 tissues exhibited a variable degree of staining, which was mostly confined to the plasma membranes of tumor cells. Correspondingly, all primary tumor specimens and the control A-431 vulvar cancer cell line gave a positive signal in the nested RT-PCR assay designed to detect CA9-expressing cells with a high sensitivity. Analysis of 77 lymph node specimens from 20 patients revealed a full correlation between RT-PCR results and standard hematoxylin-eosin staining in 75% of samples, whereas 25% of specimens were negative by the standard method and positive for CA9 mRNA, accounting for 28% of all histologically negative lymph nodes. There were no false-negatives with RT-PCR. A positive inguinal lymph node with a negative sentinel node was observed in the same groin only once in 38 specimens. Our findings clearly indicate potential value of CA9 as a molecular marker for the assessment of regional lymph node status in vulvar cancer patients and support a possible utility of our RT-PCR assay in the detection of micrometastases. ' 2005 Wiley-Liss, Inc.

show abstract

MN/CA IX/G250 as a potential target for immunotherapy of renal cell carcinomas

Cited by 134 publications

References 21 publications

CD70 (TNFSF7) is expressed at high prevalence in renal cell carcinomas and is rapidly internalised on antibody binding

CD70 (TNFSF7) is expressed at high prevalence in renal cell carcinomas and is rapidly internalised on antibody binding

Strict regulation of CAIXG250/MN by HIF-1α in clear cell renal cell carcinoma

Detection of carbonic anhydrase 9–expressing tumor cells in the lymph nodes of vulvar carcinoma patients by RT‐PCR

Contact Info

Product

Resources

About